KEGG   Polynucleobacter necessarius subsp. necessarius: Pnec_R0014Help
Entry
Pnec_R0014        tRNA      T00683                                 

Definition
(GenBank) tRNA-Met
  KO
K14230  
tRNA Met
Organism
pne  Polynucleobacter necessarius subsp. necessarius
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:pne00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Pnec_R0014
Non-coding RNAs [BR:pne03100]
 Transfer RNA
  tRNA
   Pnec_R0014
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(440158..440234)
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
cgcggggtggagcagtctggcagctcgtcgggctcataacccgaaggtcgtaggttcaaa
tcctgcccccgcaacca

DBGET integrated database retrieval system