KEGG   Pan paniscus (bonobo): 100985836Help
Entry
100985836         misc_RNA  T02283                                 

Gene name
PFN2
Definition
uncharacterized LOC100985836
Organism
pps  Pan paniscus (bonobo)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
Position
Un
NT seq 1883 nt NT seq  +upstreamnt  +downstreamnt
gggcagccaatagaaatagatatgattgtaggaaaagaccgggaaggtttctttaccaac
ggtttgactcttggcgcgaagaagtgctcagtgatcagagatagtctatacgtcgatggt
gactgcacaatggacatccggacaaagagtcaaggtggggagccaacatacaatgtggct
gtcggcagagctggtagagtcttggtctttgtaatgggaaaagaaggggtccatggaggc
ggattgaataagaaggcatactcaatggcaaaatacttgagagactctgggttctagctg
ctaggcagactgttaagtattaggggaaaattgctcttaaactttcctagctgtaagctt
aagtcttaattctggaaattttattagcaatgcagggtgatggggtatgaacctgtgtct
cctttgtatccctctgttggtggggaaaggtgtctttctttctgccctccccccccaaaa
taattctgttcacttttgttttgtttccttgtgtactccagcattggttatagtcatggg
aaaggaaggtgtccacggaggcacacttaacaagaaagcatatgaactcgctttatacct
gaggaggtctgatgtgtaagcagcctctccccatctacctagcaactgtcttcatcaaca
accctaattatggtcacaatgctaccaaactatagatggtagctaatttttctttaccta
ttttctaatgtcatgattcctgtttgcccaatggatcatttgtatgttaaccactgtatg
taaccaacccttatctggcaacataattgcagcacaataatgatttgcatgataccttga
aattggggggagggggcatgccaagttgggcatcactttgtcttagcaattaatgggata
ttgattactaaaataagttaatattaagcaaggtgccagttgtacaatctctgatcagtg
tcttttcagcactttgagcatttacttggctcatttagtcttccttttgtagcgcatggt
tgggaggaaaaagtgcatgcatcattccttcactcttctctttttcccgccccccctccc
ttcgcacataggcatttggtttgcttccatctttttttatgcagtgcctgttttttttaa
ccaattaaaatcccttttgttaatgagctattgagagctgcagtagtttgcttttagtat
tgttgttgcacttgagtagagacaaacctttattcatagtgtctacaggacatatgaaga
gtgcaatggcaaaacaagagcaaaaagcacttcctcccatgaccttacagtaaccatact
gattgaatccccagggacattccatcattgcaatagctcagatttttcttcctttttctt
tgcacaccagctctactctttagtaaaattgtaaaaggctgccattatggacattaggta
tcccaacataaccatctggagtgtgtccagtttgttcttcataggaccaatttttatttg
cagcttgagtttttatatgaagttgcattattgtggacttggctgtcttgtgatgaattt
ttttcatatgtattctgtgccatactattgttaaaatgaactgttgctattgtgagatgg
attttaactgacctattaagggtttctttcgaatggcactactttagggacattctagta
tttgcttctattgtttgggccttgtggataatgtacagatttaaaaacaaatctcgttgc
tgatttgtccatttctttccctgcactttgttacatctgggatacagtctaactcatctg
atttaatatgcatttaaaaaaatgccgtaactattaaacaccttgtttacagacagatga
aataaatttattccaaccaaata

DBGET integrated database retrieval system