KEGG   Paenibacillus polymyxa E681: PPE_00997Help
Entry
PPE_00997         gene      T01319                                 

Definition
(GenBank) pseudogene
Organism
ppy  Paenibacillus polymyxa E681
SSDB OrthologParalogGene clusterGFIT
Position
1091005..1092666
Genome map
NT seq 1662 nt NT seq  +upstreamnt  +downstreamnt
atgggcaaccgtttgttaacgcgaaagttaggatttttgacacctaagtacgaaactggt
catgattttgataacgctttccataggcctattgctacaatgacggtatatacccattct
aattaccggaggttgaatgccgtgtcatttaaagtagcgtttattggagcaggaagcatc
ggttttacccgtggaattttacgagatctgttatcagtgccggaatttaatgatattgaa
gtggcttttacggatatcagtcagcacaatctggatatggtcactgagctgtgccaaagg
gatattcgggaaaacggtttatccatacaaatacagtcctctacggaccgaaagatagct
ttaaaggatgccaaatacgtcatttgtacgatccgggttggcgggctggggggctttgca
accgatgtggatattccgctgaaatatggcgtggatcaatgcgttggcgatacactgtgt
gcaggagggattatgtatggtcagcgtggtattgctgaaatgctggccatctgcaaggat
atccgcgagctaagtgcaccggatgtattgctgctgaactactcgaaccccatggcgatg
atgacgtgggcctgcaataaatacagcggtgtgcgtacaatcggtctatgtcacggcgtc
cagcatgggcatcaccaaattgccgaggtgtatggtctggagaagcaggaggtggacatt
gtgtgcgccggaatcaatcaccagacgtggtacattcaggcgtcacatgaaggcaaggat
ctgacagctggactgctggaggcttttgaaaaacatcctgaatatagccgcaccgaaaag
gtacgcatcgacatgcttcgtcgttttggctattacagcacagagtcgaatggtcatctt
agtgaatatgtaccttggtaccggaagcgtccgaatgaaattctggactggattgatcta
ggcagctggatcaacggagaaacaggcggttatctgcgtgtatgtacagaaggacgtaat
tggtttgaaacagatttccccaactggatgaaagaagacccattggagtacaaggcggaa
aatcgcggtgaagagcatggttcatacattatcgaaggtttggaaaccggacgtgtatac
cgggggcattttaatgtcgtaaataacggcgtgatttccaatttgccagacgatgcgatt
attgaagcgcctggatatgtggatcgaaatggtatctccatgccacatgtaggagacctt
ccgctcggtcttgctgccgtctgcaatgtaagtatttccgtccagcgtttggctgttgaa
gcggctgtacacggagatgataagctgctgcggcaagcgtttatgatggatccgctagtg
ggcgcggtgtgtaatccgaaagaaatttggcagatggtcgatgaaatgctggtggcgcag
gaagcatggctgccgcaatacggagcagcgattgccgaggcgcgtcaacgtctggctgca
ggcgatctgattccaacccgaccttatgagggagcagcgcgacttaaggtgaagacggtt
gaagaaatgcaactggatcgggatgccgccaataaaaatgcagggcaatccgacaagggc
aaggatcgcgaaaaagtgtagaacaacaagaacatagattga

DBGET integrated database retrieval system