KEGG   Plasmodium yoelii: PY17X_0212000Help
Entry
PY17X_0212000     CDS       T01035                                 

Gene name
PY01440
Definition
(RefSeq) ubiquitin carboxyl-terminal hydrolase, putative
Organism
pyo  Plasmodium yoelii
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
NCBI-ProteinID: 
Position
2
AA seq 2853 aa AA seqDB search
MTNNNDGNEEDYNRSRRDISSDSEDENIENDKINNYRNYNKFNKFHEQNMNPCNADEIYV
DDNYDQNNNNLSNVRNVSNVSNVSNVSNVSNVSNISNVSNASSISNVTTNHSSVHDEREE
IEERHDYVRNSQNIFLDRNQTENNFEINKDINYNEAYSYKNLRGVAENEIELVIDNFFGK
IESNDEIYSEWKVCPNFIFRILFIPKTKSNNYMYPVSSAFVETMSKDDWVQDWGFNNVQY
YIILINQSDYRYSFCKIDNFSFSHINTDRGWHNFIPIDKIQEHGFINKKGEIILRAGVFP
FGSESYKNSRDINYNSKIRTGFVGLKNHGATCYMNALLQLLYHINIFRKSVCMMIFNIEN
IIGNKTLEFFKNKLEKKKRKKQTNRLNNHITEIDQNFKYKNKETNFEKTDKTSLKRENLK
AYQAWKHRKKKIKKKYDEIVKSGDNNQPSLSYSNIKNETNTSINSVHDDISISNKNQHNN
ISGNEQYIQLADIKKANNYEYKNSINYNNENGNENGNENGNENGNENGNENEDPSNYILD
KINSINNGNNNISNSLDSEFILKKNENVKEEDNIITNNNYIEYEVKNNKKNKNNQIQETK
KNLNKKKKILKSSSEIEENNDSENESMSVSHICSSDNLSNKSNVRPNQAQNWNGNGNGNG
NGNGNENENGNENENGNENEHIISAHKNSKKENYSSVHISNNDKNYHTNDDHIQTSSGEG
SYRCTGDNISDKSDIENIIKKRNSIIKNNEEKSENYYDVSSYYDSYSDDNLSSLSIESSY
TTSYVSCSESSGSCFYKRKKKKKKKTGNTNIDGNYYENERTKEIDYKNILIEEENEKKNI
LPTSLALQNLFYKLHTQNEAVSCKELIRSFGWNANDVFTQQDTHELLKLLLDKVEEQMKG
TVVEGSVKKMFEGQVETYIECIDIDYKSVRKETYEDIQLDVQGCNNIYESLDKAIEAEIL
EGDNIYETDGYGMQRAKKGMRFLNFPNICIFLLKRFTFDLNKMETVKLNNRFEFYKELNL
SKYCKNNEQEYILQAVSVHQGNMNSGHYYSFSYKHDQKIWLKCDDDKIYRVSEHSVINDN
FGGYDIEIENNIYTYNLCDKIKQRMKNYSAYMLVYVKKSLIPKLIKECNPAIVNPQVVKR
CKLEETINKHRNKLKQNILQYVKIKVYDKYSYIYKSFSGLPSNNIQSLFHTKFNKNKTLS
DIFFQIFKIIKNIYTKKKKKKLIYFSKIHNKSNKKQKLISSHSVVNKLYNSTHLNQSNNN
LTYQNNQNDSIIISPGINTNYHMSNEMVIDNGNNNLDNDHNKKYVKMEKADEKRYNNIIF
HDNNNNNSKHNDLIMKTQFSKNGNVQTKDNFDDISKNSNNQSDTSISTESSAHSGCTITT
LDNYIKYISKKQNLKTEKKTPRNTKIRHKKAPKKKNKIIKKNEIIKKNEIIKKNEIIKKN
EIMKKNEKIKKNEIIKKKHIQNNHSHYSKFKSNSSYDSEDTASNSFSSDDSSHTSHSDHF
SDSGNISTNTASNTTTTSPPVSSSSSSSSSSSSSSSFASTSSSSQFSSYCYSNKRNCFFV
LIPTNDTYRYLPLDLKNNGKLYLYELLKKTNREPNDLFPTIDILYLPYNKRTAISASRGS
KNKNILLFLKYFDIYAEENINDTSLLCLDVIHCDIKLKPKHLETIMINKVLKAMNKQYIT
KHNYNILKEYVQNSHNHNDNSNSNNDSCSDDSTNFSIFVEYKNKCNLIKQKKTIAHNKII
TSDLLIFNFISNYDLEKKKKFFFSLGNKKQDLYITKENISSYDLFLNANILNKIFYRKKK
LIKKNSINTHYIICNRNGIFYKIQDNTNEINNIAIIQQDQKQENILYSDSNNLCQNINNN
YFDNINKNISHQNSVQCKDNNKDEIITNSKLNYSSNRQNQISNFSDMSKSTQNHDSINLN
ILNNNNNDNLNDHEINNLYLCLKKYTKNSEQSHIFYEYSLIDQNLADKLDQFIINNNRYI
LKEKKKYSIHPESILHNTQNIFSLESKDICRDYQYPFYSPHSSDLSSIEFETLDCNNEMA
SSPDLTLKKKKKKKIRKKKHTQNTNQNNTNINDETTQIINNINYCDSNSCFPKIEKNIIN
ITNLGSHTIKKAHCYYYNSRKNDDIIDSLENLNESNISALLMSNENGPSNELIDVNYSDI
SSRSSANSVLTYTSESTDYYLDIIEEELAESVYTNKIYDHKKEAKRVQRNNKKKKIKNFN
NIKNQDEEYTQNNLYNKKTNLSLSEYDQVINKSELIPNNYNNIETPNDSIYNMESHLDNI
HYEKNIQIKSIDNVPKINDQIDDSNNIGINLISNNTTLHIDVDSIKDRTHSYNNAIPKMK
NNTNDMNDDDDKPNNQHIDIDQKFKNNHLSKKANRIIKKCGGIPSKEEPILPFYVICDYL
DYVERKMYVNRFRFKLYDPIYQLGKYRNCSGVILKSDLKKSCLNYIDSHFLFLKKELCKI
DLDIDIRCPTKQIFKHVCYKMNIDPTHILIYPYPPLNSPINFIPYNIDSFTCPPEHENDS
YHQYSDNMNCNDPNYTDVNTNSASGQISFETLIKQRTMELEHNSLTEQKTFCLSLLPFHY
KYFTRLYPHDSPKYFHYVIQLFNSHVQSVSAFTGHIKLKRPKNKYIIGNGNDLKSNNYYN
LDAESVDSTSSSDNSSSTFANNEYDSNDYTTVQDLIDKIKLEMNPYLKKRGINPKHKFRL
LFTFGPKIKYLNSNEQLIHLDFVKTNHIKNIYVTPLRMEPDFTDQQKQMLEANQLKIIHV
FNQTPSKEVFGYSFDVLVEPNDTMLEIKNKIRKRTILPKYIFDKITFFEYENGQRIWRSN
DDIINWNNKQYAIIIGEHHAPSQSKPQIGMKIA
NT seq 8562 nt NT seq  +upstreamnt  +downstreamnt
atgactaataataatgacggaaatgaagaagattacaatagaagcagaagagacatttct
tctgatagtgaagatgaaaatatagaaaatgataaaataaataattatagaaattataat
aagtttaataaatttcatgaacaaaatatgaatccatgtaatgctgatgaaatttatgta
gatgataactacgatcaaaataataataatttaagcaatgtaagaaatgtaagtaatgtg
agcaatgtaagcaatgtgagcaatgtaagcaatgtgagcaatataagcaatgtgagcaat
gcaagtagtatcagcaatgttacaacaaatcatagtagtgtacatgatgaaagagaagaa
attgaagaacgacatgattatgttagaaatagtcaaaatatttttttagatagaaaccaa
actgaaaataattttgaaataaataaagatataaattataatgaagcatattcctataaa
aatttaagaggggtagcagaaaatgaaatagaattagttatagataatttttttggtaaa
attgaaagtaatgatgaaatatattcagaatggaaagtttgtcctaattttatttttaga
attttatttataccaaaaactaaatctaataattacatgtatccagtttcatcagctttt
gttgaaacaatgtcaaaagatgattgggtgcaagattggggatttaataatgtacaatat
tatattatattaattaatcaatcagattatagatattcattttgtaaaatagataatttt
agtttctctcatataaatacagatagaggatggcataattttattcctattgataaaata
caagaacatgggtttataaataaaaaaggagaaataatattaagagctggtgtattccct
tttggttcagaatcttataaaaatagtagagatataaattataatagtaaaatacgaaca
ggatttgttggtttaaaaaatcatggtgctacatgctatatgaatgctttgttacaactg
ttatatcatatcaacattttcagaaaatctgtttgtatgatgatatttaatattgaaaat
atcattggaaataaaactcttgaattttttaaaaataaattagaaaaaaaaaaaagaaaa
aaacaaaccaatagacttaataaccatattacagaaattgaccaaaattttaaatataaa
aataaagaaactaattttgaaaaaacagataaaacatctttaaaaagggaaaaccttaaa
gcatatcaggcttggaaacatcgaaaaaaaaaaattaaaaaaaaatatgacgaaattgtt
aaaagtggcgataataaccaaccatctttatcatatagcaatataaaaaatgaaacgaat
acatctataaatagcgtacatgatgatatttccatttcaaacaaaaatcaacacaataat
atctctggaaatgaacaatatattcagcttgctgatataaaaaaagcaaataattatgaa
tataaaaattcgataaattataataacgaaaatgggaacgaaaatgggaacgaaaatggg
aacgaaaatggaaacgaaaatggaaacgaaaatgaagatccctctaattatatattagat
aaaataaattccataaacaatggaaataataatatttcaaatagtttagattctgaattt
attttaaaaaaaaatgaaaatgtaaaagaagaagataatataataactaataataactat
attgaatatgaagtgaaaaataataaaaaaaataaaaataatcaaatacaggagacaaaa
aaaaatttaaataaaaaaaaaaaaattcttaaatcttcaagtgaaatagaagaaaataat
gattctgaaaatgaatccatgtcagtttcgcacatctgctcttctgacaatttatcaaac
aaaagcaatgtccgcccaaatcaggctcaaaactggaatgggaatgggaatgggaatggg
aatgggaatgggaatgagaatgagaatgggaatgagaatgagaatgggaatgagaatgaa
cacataataagtgctcacaaaaatagtaaaaaagaaaactacagttccgtgcacatttca
aacaatgataaaaactatcacactaatgatgaccatatccaaacgtcaagcggagaaggg
tcatatagatgcactggtgacaatattagcgataaaagtgatatagaaaatataattaaa
aaacgaaatagtataataaaaaataatgaagaaaaatcagaaaattattatgatgttagt
agctattatgatagttattctgatgataatttgtcatctctttcaatagaatcttcttat
acaacctcttatgttagttgttctgaatcatcaggatcttgcttctataaaagaaaaaaa
aaaaaaaaaaaaaaaactggaaatactaatattgatggaaattattatgaaaatgaacga
actaaagaaatagattataaaaatatattaatagaagaagaaaatgaaaaaaaaaatatt
ttaccaacatctttggctcttcaaaatttattttacaaacttcatacacaaaatgaagct
gtttcatgtaaagaattaattagatcttttggatggaatgcaaatgatgtttttacacaa
caagatacacatgaattattaaaactattattagataaagtagaggagcaaatgaaaggt
accgtagttgagggttctgtcaaaaaaatgttcgaaggtcaagttgaaacatatatagaa
tgtatagatatagattataaaagtgttagaaaagaaacatatgaagatattcaattagat
gtacaaggatgtaataacatctatgaatcattagacaaagcaatagaagcagaaatatta
gaaggtgataatatatatgaaacagatggatatggtatgcaacgggctaaaaaaggaatg
agatttttaaattttccaaatatttgtatttttttattaaaaagatttacatttgattta
aataaaatggaaacagtcaaattaaataatagattcgaattttataaagaattaaatttg
tcaaaatattgtaaaaataatgaacaagaatatattttacaagcagtatctgtacatcaa
ggaaatatgaatagtggccattattattcttttagttataaacatgatcaaaaaatttgg
ttaaaatgtgatgatgataaaatatatagagttagtgagcattcagttattaatgataat
tttggaggttatgatatagaaatcgaaaataacatatatacatataatttatgtgataaa
ataaaacaaaggatgaaaaattatagtgcttatatgttagtatatgttaaaaaatcatta
atacctaaattaataaaagaatgtaatccagctatagttaacccccaagttgtaaaaaga
tgtaaacttgaagaaacaattaataaacatagaaataaactaaaacaaaatattttacaa
tatgttaaaatcaaagtatatgataaatatagttatatttataaatcattttctggatta
ccatcaaataatatacaatctttatttcatacaaaatttaataaaaataaaaccctttct
gatattttttttcaaatttttaaaataattaaaaatatttatactaaaaaaaaaaaaaaa
aaattaatttatttttctaaaatacataataaatcgaataaaaaacaaaaactaatatca
tcacattctgtggttaataaattatataattctacacatctcaatcaaagcaataataat
ttaacttatcaaaacaatcaaaatgattctattattatatcaccaggaattaatactaat
taccacatgtctaatgaaatggtaatagataatggaaacaacaatttagacaatgatcat
aataagaaatatgttaaaatggaaaaagctgatgaaaaaagatataacaatataattttc
cacgataataataataataatagcaaacataatgatttaattatgaaaacacaattttct
aaaaatggaaatgttcaaacaaaagataattttgatgatatttcaaaaaattcaaataat
caatcagatacaagcatatctacagaatcttctgctcattcaggatgtactataactact
ttagataattacattaaatatatttctaaaaaacaaaatttaaaaactgaaaaaaaaaca
ccaagaaataccaaaatcaggcataaaaaggcacccaaaaaaaaaaataaaataataaaa
aaaaacgaaataataaaaaaaaacgaaataataaaaaaaaacgaaataataaaaaaaaat
gaaataatgaaaaaaaatgaaaaaataaaaaaaaatgaaataataaaaaaaaagcatatc
caaaataatcattctcactattcaaaatttaaatctaattcatcttatgattcagaagat
actgcatctaattcatttagttcggatgattcatcacatacttcccattcagatcatttt
tcagattctggaaatatttcaacaaacactgcatctaacacaactactacatcacctccc
gtttcttcgtcttcttcttcttcttcctcttcttcctcttcctcatcttttgcatcaaca
tcttcatcttcacagttttcgtcatattgttattcaaataaaagaaattgtttttttgtt
ttgattccaacaaatgatacatatagatatctaccactagatctcaaaaataatggaaaa
ttatatttatatgaattacttaaaaaaaccaatagagaaccaaatgatttattcccaaca
atcgatatattatatcttccttataataaacgaactgctatttctgcatctagaggttct
aaaaataaaaatatattactttttttaaaatattttgatatatatgcagaagaaaatata
aatgacacatcattattatgtctagatgttatacattgtgatataaaattaaaacccaaa
catttagaaactataatgataaataaagtgttaaaagcaatgaataaacaatatataaca
aaacataattataatattttaaaagaatatgtacaaaatagtcataatcataatgacaat
agtaatagtaataatgattcatgttcagatgattcgactaattttagtatttttgtggaa
tataaaaataaatgcaatttaataaaacaaaaaaaaactattgcacacaataaaattatt
actagtgatttattaatatttaattttattagcaattatgatttagaaaaaaaaaaaaaa
ttttttttttctttaggaaacaaaaaacaagatctatatattactaaagaaaatatatca
tcttatgatctctttttaaatgcaaatatattaaataaaattttttatagaaaaaaaaaa
ttaataaaaaaaaattcaataaatacacattatataatatgtaatcgaaatggtatattt
tataaaattcaagataacacaaatgaaataaataacattgcaataattcagcaagatcaa
aaacaagaaaatatattatattcggattcgaataatttatgccaaaatataaacaataat
tattttgataatataaataaaaatatatcacatcaaaattctgttcaatgtaaagataat
aacaaagatgaaattatcacaaattctaaattaaattattcatctaatagacaaaatcaa
atttcaaatttttcagacatgtcaaaatcgacacaaaaccacgattcaataaatcttaat
atattaaataataataataatgacaatttaaatgatcatgaaataaataatttatattta
tgtctaaaaaaatacactaaaaattctgaacaaagtcatattttttatgaatatagcttg
attgatcagaatttagctgataaattagatcaatttataattaacaataatcgctatatt
ttgaaagaaaaaaaaaaatatagtattcatcccgaatctattttgcataatactcaaaat
atattttctcttgaatcgaaagatatatgtcgtgattatcaatatccgttttattctcca
cattcatctgatttatcatctattgagtttgaaacattggactgtaataatgaaatggct
agctctcctgacctcactttaaaaaaaaaaaaaaaaaaaaaaatcagaaaaaaaaaacac
acacaaaatactaaccaaaacaatacaaatatcaatgatgaaacaactcaaattataaat
aatataaattattgtgattcaaattcatgctttcctaagattgaaaaaaatataataaac
attaccaacttaggatcccatacaataaaaaaggcacattgttattattataattctcga
aaaaatgatgacataattgattcattagaaaatttaaatgaatctaatattagtgcacta
ttaatgtcaaatgaaaacggtccatctaatgaattaatagatgtaaattattcagatata
tcttctcgttcttctgctaattctgttttaacttacacatctgaaagtacagattattat
ctagatattattgaagaagaattagcagaatctgtttatactaacaaaatttatgaccac
aaaaaagaagcaaaacgggttcaaaggaataacaaaaaaaaaaaaattaaaaattttaat
aatataaaaaatcaagatgaagaatacacacaaaacaatctttataataaaaaaacgaat
ctttctttatcagaatatgaccaagtcataaataaatccgaattaataccaaacaattat
aataatatagagacaccaaatgattctatatataatatggaatcacatctagataatatt
cattatgaaaaaaatatccaaattaaaagcatagataatgtccccaaaataaatgaccaa
attgatgactcaaataatatagggattaatttaatttctaataatactacattacacata
gatgtagattctataaaggatagaacccattcttataataatgctataccaaaaatgaaa
aacaataccaatgatatgaatgatgatgatgataaacctaataatcaacatattgatatt
gatcaaaaatttaaaaataatcatctcagtaaaaaagcaaatagaatcattaaaaaatgt
ggaggtataccaagcaaagaagaacccattttacctttttatgttatatgtgattattta
gattatgtagaaagaaaaatgtatgttaacagattcagatttaaattatatgatcctata
tatcaattaggaaaatatcgaaattgttcaggtgttatattaaaaagtgatttaaaaaaa
agttgtttaaattatattgattcacatttcttatttttaaaaaaagaattatgtaaaatt
gatttagatatagatattagatgtccaacaaaacaaatatttaaacatgtatgctataaa
atgaatattgatcctactcatatattaatatatccttaccccccattaaatagtccaatt
aatttcattccatataatatagattcatttacttgcccacctgaacacgaaaatgattct
tatcatcaatattctgacaatatgaattgtaatgatcctaattatacagatgtaaacaca
aattctgcatctggacaaatttcttttgaaactttaataaaacaacgcaccatggaatta
gaacataattctttaactgaacaaaaaacattttgtttatctttgttgccatttcattat
aaatattttacaagactatatcctcatgattctccaaaatattttcattatgttattcaa
ttatttaattcacatgtacaatctgtttctgcatttactggtcatattaaattgaaaagg
ccaaaaaataaatatatcataggtaatggtaacgatttgaagtctaataactattacaac
ttagatgcagaaagtgtcgattctacatctagttcagataattctagtagcacctttgct
aataatgaatatgattcaaatgattataccaccgttcaagatctaatagataaaatcaag
ttagaaatgaatccatatttaaaaaaaagaggaatcaatccaaaacataaatttagatta
ttatttacctttggacctaaaattaaatatttgaacagcaacgaacaattaatacatctg
gattttgtaaaaacaaatcacattaaaaatatatatgtaactccccttcgaatggagcca
gactttacggatcaacagaagcagatgctcgaagcgaatcaattgaagataattcacgtc
tttaatcaaaccccatccaaagaagttttcggatacagttttgacgttttagtagagcct
aatgatactatgctagaaataaagaacaaaatacgaaagagaacaattttaccgaaatat
atatttgacaaaattacattctttgaatatgaaaatggccaaagaatttggagatctaac
gacgatattataaactggaataacaagcaatatgccattatcattggagagcatcatgcc
ccatcgcaatcaaaaccacaaataggaatgaaaatagcatag

  All links  
No link information was found.   
DBGET integrated database retrieval system