KEGG   Rahnella aquatilis CIP 78.65 = ATCC 33071: Rahaq2_4353Help
Entry
Rahaq2_4353       CDS       T01770                                 

Definition
(GenBank) putative small periplasmic lipoprotein
Organism
raq  Rahnella aquatilis CIP 78.65 = ATCC 33071
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: LPAM_2
Motif
Other DBs
NCBI-ProteinID: AEX54105
UniProt: H2IWQ6
Position
complement(4635200..4635403)
Genome map
AA seq 67 aa AA seqDB search
MKNALRWSLAATILFSLSGCGLKGPLYFPPPEKSATQKTSNVPGTANDGSSQEKGVSPEN
LTTNSRD
NT seq 204 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaacgctttacgctggtctctggccgcgacaatactcttttctctctccggttgc
ggactgaaagggccgttgtatttcccaccgccggaaaaatcagctacgcaaaaaaccagc
aatgttccgggtacggcgaacgatggttcgtcgcaggaaaaaggtgtatcaccagaaaac
ctcacgacgaattccagagattga

DBGET integrated database retrieval system