KEGG   Rickettsia bellii OSU 85-389: A1I_t07963Help
Entry
A1I_t07963        tRNA      T00602                                 

Definition
(GenBank) tRNA-Trp
  KO
K14235  
tRNA Trp
Organism
rbo  Rickettsia bellii OSU 85-389
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:rbo00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    A1I_t07963
Non-coding RNAs [BR:rbo03100]
 Transfer RNA
  tRNA
   A1I_t07963
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
287647..287722
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
aggagtgtagctcaattggtagagcaccggtctccaaaaccggaggttgcgggttcgatg
cctgtcgctcctgcca

DBGET integrated database retrieval system