KEGG   Rhodospirillum centenum: RC1_0031Help
Entry
RC1_0031          tRNA      T00785                                 

Definition
(GenBank) tRNA-Ser
  KO
K14233  
tRNA Ser
Organism
rce  Rhodospirillum centenum
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:rce00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    RC1_0031
Non-coding RNAs [BR:rce03100]
 Transfer RNA
  tRNA
   RC1_0031
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
23442..23533
Genome map
NT seq 92 nt NT seq  +upstreamnt  +downstreamnt
ggaggggtggccgagcggctgaaggcaacggtttgctaaaccgtcatacggggaaactcg
tatcgtgggttcgaatcccatcccctccgcca

DBGET integrated database retrieval system