KEGG   Rhodospirillum centenum: RC1_0062Help
Entry
RC1_0062          gene      T00785                                 

Definition
(GenBank) pseudogene
Organism
rce  Rhodospirillum centenum
SSDB OrthologParalogGene clusterGFIT
Position
50028..51011
Genome map
NT seq 984 nt NT seq  +upstreamnt  +downstreamnt
gtgcatgacgtggctctatctgccactggcgctgctggcggcggccccctgttcgggctg
tcgctgtgcgccggggccggcggtctcgaccttggcctgcacatcgccgaacccggatac
cgtgctgtgggttatgtcgagcgggacgcctacgccgcggccgtcctcgtggcgcggatg
gcggacgcggccctggatccggcacctgtctgggacgaccttgccagcttcgacggtcgc
ccatggcgtggcgcggtggacctcgtgcttgcgggctatccgtgccagccgttcagcgtc
gccggacgtcgtcgcggaaccgacgatccccggcatctttggccccatgtcgcgcgcatc
atcgacgagcgccgaccgggatctgttttcctggagaacgtccccaatcatctcaacctc
ggctatcgcgaggtccggaagagctggaaggaatgggtttcgtcgttgcggagggattgt
tctcggcggcggaagtcggtgctccccatcgacgcgaacggctgttcgtcctcgcccgcc
ggttggccgacgccccgggcctgttcgggcaagcgctccagcggggcgaaccgcaccgaa
ttgctgcgcctgtggtcgacggcgaaggccagcgacggcaaccggccgggtgccggacgg
cgccgcgaggccgacctgaccgggcgtgcccgctgctgggcgaccccgtcggcgcgcgac
tggcgcagcgggctggccgggccggagacgatggcgcgcaacagccgccccttgaacgag
caggcggtgagcgggcgttcccgcccggccccggagacgataatgggtggcgggagtggc
tgcggcgacaccccgacactgaacccgcggttcgtcgaggcgctgatgggctggccttcc
gggtggaccggcttcgcctctgtggcaacggcgtggcccccctggttgcggcttatgcgt
ggcgaactctctcggctcggctag

DBGET integrated database retrieval system