KEGG   Rhodospirillum centenum: RC1_4122Help
Entry
RC1_4122          tRNA      T00785                                 

Definition
(GenBank) tRNA-Leu
  KO
K14228  
tRNA Leu
Organism
rce  Rhodospirillum centenum
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:rce00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    RC1_4122
Non-coding RNAs [BR:rce03100]
 Transfer RNA
  tRNA
   RC1_4122
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
4344332..4344418
Genome map
NT seq 87 nt NT seq  +upstreamnt  +downstreamnt
gcccccgtggcggaattggtagacgcggcagactcaaaatctgttgcccggaagggcatg
ttggttcgagtccgaccgggggcacca

DBGET integrated database retrieval system