KEGG   Rhodospirillum centenum: RC1_4126Help
Entry
RC1_4126          gene      T00785                                 

Definition
(GenBank) pseudogene
Organism
rce  Rhodospirillum centenum
SSDB OrthologParalogGene clusterGFIT
Position
4346875..4347117
Genome map
NT seq 243 nt NT seq  +upstreamnt  +downstreamnt
atgcggaacggcgttccctacaacgtcttctccgacacggcgaacatccagcagatcgac
gtcgtcaagggcgccaattccatcctctacggcttcaacgatccgggcgggctgatcaac
tacatcacccgggcgccgcaggaggcggcctacagcgtgagcagaccatcggctccttcg
actattaccggaccgaggccgatgcgaccggcccgctgttcggcgacacgcgctaccgcc
tga

DBGET integrated database retrieval system