KEGG   Rhodobacter capsulatus: RCAP_rcc00606Help
Entry
RCAP_rcc00606     CDS       T01213                                 

Definition
(GenBank) lipoprotein, putative
Organism
rcp  Rhodobacter capsulatus
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ADE84371
UniProt: D5ANL7
Position
651977..652432
Genome map
AA seq 151 aa AA seqDB search
MTSRLALALITVTALSACGSNSSFRLYPLSGPIAEQNPSTAIPISITEDSETSGQIWFKL
PKPNKTKCSGTWSSVQPRVKTHERGLSLKLKDLGGSYKNSTEDVGGVNTGEVYAVCKDGT
RLQGTFIMGSGTQSGTGTVTDTLGNSYKLLF
NT seq 456 nt NT seq  +upstreamnt  +downstreamnt
gtgacctcgcgtcttgcgcttgccctgatcaccgtcactgcgctgtcggcctgcgggtcg
aacagttcgttccggctttatccgctgagcgggccgatcgccgagcagaacccctcgacg
gcgattccgatctcgatcaccgaggacagcgagacctcggggcagatctggttcaagctg
ccgaagccgaacaagaccaaatgcagcggcacctggtcgagcgtgcagccgcgggtgaag
acgcatgaacgcggcctgtcgctgaagctcaaggatctgggcggcagctacaagaattcg
accgaggatgtcggcggcgtcaacaccggcgaggtctatgccgtgtgcaaggacggcacc
cggctgcaggggaccttcatcatgggctcgggcacgcaaagcggcaccggcacggtgacc
gacacgcttggcaacagctacaagctgctgttctga

DBGET integrated database retrieval system