KEGG   Rhizobium etli CFN 42: RHE_CH00356Help
Entry
RHE_CH00356       gene      T00317                                 

Gene name
fadB1
Definition
(GenBank) fadB1
Organism
ret  Rhizobium etli CFN 42
SSDB OrthologParalogGene clusterGFIT
Motif Motif
Other DBs
RhizoBase: 
Position
367540..369184
Genome map
NT seq 1645 nt NT seq  +upstreamnt  +downstreamnt
tggcgccggcgatggagggggctcgcgtcacgaggctggagctgcgccgcagggatctgc
gcttcccctttcccgatgccctggcggagagggtttccggccgcaccatcgtcgggcttg
gccgccgcgccaaatatctgctggtcgatctcgacgacggcaatacgctgatttcccatc
tcggcatgtccggttccttccgcatcgaggagggtgcggcctcggcgatgccgggcgaat
tccaccatgcccgcagcaaggacgagaagcacgatcacgtcgtctttcacctcgaaggcg
gaggcgggccgcgccgcgtcgtctataacgatccgcgccgtttcggcttcatggatatcg
tggggcgtgccgatctttccgcgcatcccttcttccgagacctcggcccggagccgacgg
gcaacgagctcggcgccacctatctcgccgaacggttccgcgataaggcacagcccttga
agagcgcgctcctcgaccagaagaacatcgccggtctcggcaatatatatgtctgcgaag
cgctgtggcgctcgcacctttcgccgatccgcgccgccggcacgctggtgacatcaggcg
gccggccgaagcagcagctcgacctgctggtcgcctcgatccgcgaggtcatcgccgacg
cgatcgccgccggtggctcgtcgctgcgcgaccatatccgggcggatggatcgctcggct
atttccagcattccttctccgtctatgatcgcgaaggtcaggcttgcggcacgcccggct
gcggcggtacggtcgcccgtatcgtacaggcgggtcgctccaccttctattgcgccgcct
gccagaaataacagagaaccgggagaccagcatggcctacgagaccctgatcgtcgaaac
ccgaggcaatgtcggcctcgtcacgctgaatcgcccgcaggcgctgaacgcattgaattc
caccgtcctgaaggagttgaaggcggcctacgccgcgttccacgccgacgaggcgatcgg
cgccatcgtcatcaccggctccgaacgcgcctttgccgccggcgccgatatcaaggagat
gcagtcgctccagttcgccgacatctataagagtgacttcatcagcggctgggacgacat
tgccaaggcgcgcaagccggtcatcgccgccgtcagcggctttgccctcggcggcggctg
cgagctcgccatgatgtgcgatttcatcatcgcctcggagacggcgaagttcggccagcc
ggaaatcaccctcggcgtcatccccggcatgggcggctcgcagcggctgacgcgcgccgt
cggcaaggcgaaggcgatggatcttgtcctgaccggccggatgatggatgcggctgaagc
cgaacgatcgggactcgtttcgcgtgtggtggcgcccgagcgtcttctcgacgaggcgct
tgccgcggccgaaaagatcgcctcgctttcgcagccctccgtcatgatggccaaggaggc
ggtcaaccgcgccttcgagacgacgctggaggaagggttacggttcgaacgccgcctgtt
tcatagtctctttgccacggacgatcagaaagaaggcatggcggccttcgtcgagaagcg
caaacctgcctttaagcaccgttga

DBGET integrated database retrieval system