KEGG   Rhizobium etli CFN 42: RHE_CH00640Help
Entry
RHE_CH00640       gene      T00317                                 

Gene name
cheW1
Definition
(GenBank) cheW1
Organism
ret  Rhizobium etli CFN 42
SSDB OrthologParalogGene clusterGFIT
Other DBs
RhizoBase: RHE_CH00640
Position
660758..663477
Genome map
NT seq 2720 nt NT seq  +upstreamnt  +downstreamnt
aggagtgcgaggaacagctcgccgagctggaatccggtcttctgaaaatgaacgatggcg
atcgcgatccggaaaccgtcaatgcggtgttccgtgccgtgcattcgatcaaggggggcg
ccggcgccttcggccttgatgatctcgtagccttcgcccatgttttcgagaccactctcg
attgcgttcgctccaacaagctcgagccgacccaggatgtcctgaaggtgatgctgaagt
cggccgacgtgctcgccgacctgaccaatgccgcgcgcgacggcggcagtgtcgatgaaa
gccgcagccgtggtctcgtcaaggagctcgaggcgctggccaatggcgagctgccgtctc
cttcggccgaaccgcctgcgcccaaggccgccgcaaaggcggctccggccgctcctgcgc
cggccgccaagccgactgacgacagcggcttccagccgatccccttttccttcgacgatt
tcggcgatgaggacggcgcagagaccggtctgccggcctacgagatcaccttcaagccgc
gccacgaactctattcgaagggtaatgacgccaccctgctgctacgcgacctttcgcgcc
tcggcgaaatgacgatctattgcaatatggatgagctgcccggtctcgaggagctcgatc
cggaggctgcctatttcttctggaacatcacgatcaagaccgacaagggtgaagacgcca
tccgaaccgtcttcgaattcgctgaatgggattgcgacctcacggtaaagccagtcgagg
aagcaagcgccggcgtgaccggcaatgaggaactgccgatggtgccggttcccttcgacc
tgtcgatcctggacgaaaccgacgcagcggaagccgtttccgcggcacggtccgaagaca
cggccgctgccgttgctgccgccgagaccgcttccaatgtcacgcagatggcggccgccg
ccgctcgcgtcgaaaagaaggaatcggccgccgccgcagccgccgcggccaatgccgccg
cccagaacaacgccgccggcgccggccagacgatccgcgtcgatctcgatcgcgtcgacc
gtctcatcaacctcgttggcgaattggtcatcaaccaggcgatgctgtcgcagagcgtca
tcgagaacgacacaaccggcacgtcttcgatcaacatgggtctcgaggagctgcagcagc
tcacccgcgagatccaggattcggtcatggcgatccgcgcccagccggtcaagccggtct
tccagcgcatgtcgcgtatcgtccgcgaaatcgccgacatgactggcaagtcgatccgcc
tcattaccgaaggtgagaataccgaagtcgacaagacggtcatcgacaagctggccgagc
cgctgacccacatgatccgcaatgccgtcgaccacggcatcgaaacgccggaaaagcggg
ctgccgccggcaagaacaccgaaggcacggtgcgcctcaccgccaagcaccgctcgggac
gcattctgatcgagcttgccgacgacggcgccggcatcaaccgcgaaaaggtccgccaga
aggcgatcgacaatgacctgatcccggccgacgcgaacctgtcggacgaggaaatcgaca
acctgatcttcctgccgggcttctcgacggccgacaagatctccgacatatcaggccgcg
gcgtcggcatggacgtcgtcaagcgctcgatccaggcgctcggcggtcgcatcaacatca
cgtccaagccgggccacggctcggtcttcaccatgagcctgccgctgacgctcgccgttc
tcgacggcatggtggtcactgtcgccggccagacgctggtcgtgccgctgaccgcgatcg
tcgaaaccctgcagccggaagctgccgcgatccactccttcggcgccaaccaccggctga
tctcgatccgcaactcgttctgcccactggtcgatgtcggccgcatcctgaacttccggg
caacccaggccaaccccgtcgaaggtgtggcgctcctggtggaatcggagggcggcggcc
agcgcgccctgatggtcgatgccatccagggtcagcgccaggtggtcatcaagagcctgg
aggccaactacacccatgtgcccggcatcgccgccgccaccattctcggcgacggccgcg
tggctctcatccttgatgtcgacgcggtggtcggcgcctcgcgcggccactcgctcaaag
cggaaatgtcgttagcagcggtagggtaaggaatgtcgtacgctgtaaaaagtctgaacc
agggggatcgcgagctgatcgcgttccgcatcggagatcaggaattttgcgtgaacatca
tgtcggttcgcgaaatccggggctggacccccgcgaccgcgatgccgcactcacctgcct
atatgctgggggtcatcaacctacgcggcgcggtgctgccgatcatcgatcttgctgctc
ggctcggcatgaagccggccgatccgactgcccgtcacgtcatcatcgtcgcccaggtcc
gtcgtaaagtcgtcggcctcctggtcgacgccgtctccgacattctgacggtgaccgacg
agatcattcagccgacgcccgaaatctcctccgacctcgagcgccagtttgcccggggca
ttctcgccatcgacaagcgcatgatctgcctgatcgaactcgaagccctcttttctgaga
ccgaaagcgaagccgcatga

DBGET integrated database retrieval system