KEGG   Rhizobium etli CFN 42: RHE_CH00642Help
Entry
RHE_CH00642       gene      T00317                                 

Gene name
cheBch1
Definition
(GenBank) cheBch1
Organism
ret  Rhizobium etli CFN 42
SSDB OrthologParalogGene clusterGFIT
Other DBs
RhizoBase: 
Position
663530..665422
Genome map
NT seq 1893 nt NT seq  +upstreamnt  +downstreamnt
cggagaatatccgctgacgcgccgcgacctcacggaaatcgccgcaatgatctactcgga
tgccggcatcttcctcaacgagaccaaggcctcactcgtctattcgcgtctgtcgaagca
catccgcaatctcggcctgtcgggtttccgggaatattgcgaactcgtcgcttcgccggc
cggtgccgcggcgcggcgcgaaatgctctcgcatctgacgaccaatttcacccgcttctt
ccgcgagaaccatcatttcgagcatctgcgcgaccatgttctgccggagcttctgcagcg
ggcgagatcgggcggcagggtacgcatctggtcggctgcttcgtccgacgggcaagaacc
ctattcgatcgcgctgaccgtgctgtcgctgatgccgaatgtcgccgattacgacttcaa
gatcctggcgacggacatcgatccgaaaatcctcgccatcgcccgggccggcgcttacga
cgagagcgcgctcgaaaccgtctcgccggccatgcgcaagcaatggttcagcgaagtcga
ggtgcagggccggcgcaagttccaggtcgacgaccgcgtcaagcggctgatcacctacaa
cgagctgaacctgatggcgcaatggccgttcaagggcaagttcgacgtcatcttctgccg
caacgtcgtcatctatttcgacgagccgacgcagatgaagatatggcagcgtttcgccgg
tttgctgccggagggcggccatctctatatcggccattccgagcgtgtctcgggcgaggc
gaaacacgtcttcgacaatatcggcatcacgacctatcgctacacgaccaagggtctcgg
gaggaaggcatgagcgctccggcacgggttctcgttgttgacgactcgccgaccatgcgg
ggtttgattaccgcggtcctgagctccgacccggaagtcagcgtcatcggccaggccggc
gacgcgctggaagcgcgcgaagcgatcaagcggctgaatcccgacgtcgtgacactcgac
atcgagatgccgaacatgaacggcctcgatttccttgaaaagatcatgacgctgcggccg
atgccggtgatcatggtctcgacgatgacgcatcgcggcgccgaagcgacgcttgcggcg
cttgagatcggcgccttcgattgcgtcggcaagccgggtcccggcgaacacaggccgttc
ggcgatctcgccgagaaggtcaaggcggccgcgcgcacgcagcgtcagttctcccaaccg
gcggccgccgtcgcgcccccgccttccgtcgccgatttccgcgtcggccgtaagatcgtc
gcgatcggctcgtcgaccggcggcgtcgaggcgctgatcgccgtactgcagaaattcccg
gcaaattgcccgccgaccgtcatcactcagcatatgccgcccaccttcaccaagagtttc
gccgaacggctaaaccgtctctgcgcgccggtcgtgcaggaagcgaccgacggcgcccgt
ctcgagatcggcaagatctacctggcgccgggcggcgaacgccatctccaggtcagcggc
gggtccgcgccatgctgccgtctcgtcgaccgggcgcccgtcaacggtcaccgcccgtcc
gtggacgtgctctttgattcggtcgcggaactcgcaggccgcaatgccgtcggcgtgatt
ctgaccggaatgggccgagatggcgccgccggattgttgaaaatgcgccacgcgggcgcc
agaacgctcggccagaccgaaaaaacctgcgtcgtttacggaatgccaagggttgctcac
gaacttggcgccgtcgagcagcagctgccactgactgccatcggtgaagagatattgaag
ttgacagccgcccgaaaggaagggaccgaataa

DBGET integrated database retrieval system