KEGG   Rhizobium leguminosarum bv. viciae 3841: pRL120435Help
Entry
pRL120435         gene      T00402                                 

Definition
(GenBank) pseudogene
Organism
rle  Rhizobium leguminosarum bv. viciae 3841
SSDB OrthologParalogGene clusterGFIT
Other DBs
GeneDB: pRL120435
RhizoBase: pRL120435
Position
pRL12:complement(join(469477..469917,469918..470040,470041..470121))
Genome map
NT seq 645 nt NT seq  +upstreamnt  +downstreamnt
ttgtgggacgggcagacgatcttgcaattagtggatcgggtcggtgaggaagggttgatt
tacggtgtagatattccagaatagctcctcgcggtcgccggtcaacgtacgagccaatgc
aaatgtgttcgcttgattgaggttgacgctcaggttctggagctaccccccgcagcgtgg
atgcgattttctcccgttttggcgtgatgtcatttggcgatccaatagccgctttctcca
atttccatcgggttgctaaagctcgatggcaggcttgcattctgctgttggcggcccttt
cgggataatgaattggacaggtttccgttacttgcggcgggatttcaatcgccagaagac
gacacccctttcagcttttcagacgcgggatatgttcacaacgttctgatgtctgccgga
tttaaagacattgcgatcgtgccttatgacgaagcagtgacaagtggtgacgttgacgca
atgacgcgcgtgctgttgagcattggcccgcttggtaaaattgctcgcgagaacgccatg
atcaagtcgacggcgcaacccaagttgcgcgaagcactcgcagggctcgaaaacccggcg
agcgtggcactagtcgcctcgatatggatagtaacagcgagggcc

DBGET integrated database retrieval system