KEGG   Rhizobium leguminosarum bv. trifolii WSM2304: Rleg2_5731Help
Entry
Rleg2_5731        gene      T00779                                 

Definition
(GenBank) pseudogene
Organism
rlt  Rhizobium leguminosarum bv. trifolii WSM2304
SSDB OrthologParalogGene clusterGFIT
Position
pRLG202:complement(130809..130868)
Genome map
NT seq 60 nt NT seq  +upstreamnt  +downstreamnt
ggcgccaggctatggttcttgccgaaatactcgccggacctaaatccgattgagcagagt

DBGET integrated database retrieval system