KEGG   Rattus norvegicus (rat): 498731Help
Entry
498731            misc_RNA  T01003                                 

Gene name
RGD1563601
Definition
(RefSeq) similar to Tpi1 protein
Organism
rno  Rattus norvegicus (rat)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
RGD: 
Ensembl: 
Position
17p12
NT seq 1383 nt NT seq  +upstreamnt  +downstreamnt
actaagagcaggtttttgtactgaccttcagagagttgatccttgtgcaatggcgccttc
caggaagttcttcgtcgggggcaactggaagatgaacgggaggaagaaatgcctgggaga
actcatctgcaccctgaacgcagccaagatgccggcagacaccgaggtggtttgtgcacc
gccaaccgcctacatcgacttcgccaggcagaagctggatcccaaaattgctgtggctgc
acagaactgctacaaagtgaccaatggggccttcactggggaaatcagccctggcatgat
caaagacttaggagctacctgggtggtgctgggacactcggaaagaagacacatctttgg
ggaatcagacgagttgattgggcagaaagtgaaccatgccctatccgagggactcggagt
gatcgcctgcattggggagaagttagacgaaagggaagctggcatcactgagaaggttgt
ttttgagcaaaccaaggccatcgcagataatgtgaaggactggtccaaggtggtcctggc
ctatgaaccggtatgggccattgggactggcaagactgcaacccctcaacaggcccagga
agtacacgagaagctccggggatggctgaagtgcaacgtctctgaggaggtggctcagtg
cactcggatcatttatggaggttctgtgactggagcgacttgcaaagagctggcaagcca
gcctgatgtggatggcttcctcgtgggcggtgcatctctcaagcctgaattcctggacat
tatcaatgccaaacaatgagcactgctcatccccctaccttcctgcgtagcctggaccag
gttgcccagaagtttagtaactgctcccgccagtcacatgcttctgatgacatcatcaac
tccatcttgtgacctaatccatactgtaccttcctgagtctcttacctccccataatagt
tgggaccaggccaatccctttaccacttacaatgggtaaaatcaaatatgtcaccaagat
ggcttcctgaggaggggaaggagtagaactggctgtccctttgggccctaatgggtgaaa
acggccttccattggtttgggatggaaactcacggctggaccacaggaagtaggcttctt
gtcactttggcctgtcacttagatggccttggctctagcttcactcccaagccctactgg
atgtgtgatgcagagattcagagtcttcgggtctgaatttcagtgtacattaaggccaag
atcctcttcctcttagaggcctgggatatcccctcccccgcagtgccgaagcccttgtat
tgtgtttgtgaaccatcctacgtataagggaaataaacacctgggcctaaaaaaaaaaaa
aaa

DBGET integrated database retrieval system