KEGG   Rattus norvegicus (rat): 499969Help
Entry
499969            misc_RNA  T01003                                 

Gene name
RGD1565588
Definition
similar to calcium binding protein P22
Organism
rno  Rattus norvegicus (rat)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
RGD: 
Position
4q11
NT seq 2541 nt NT seq  +upstreamnt  +downstreamnt
atgcgtcagcagactggtatggaacgcagagggggtttccctccccgggccgcaggagaa
acagtgccctctcccttcttgacccccggcccttccctcccttattccctcttgccgccg
ctgcgtctggcgctgccactcccggaggagctcccgtcactggggtctcgggcctccacg
ttactgcgggacgaagagctcgaggagatcaagaaggagactggcttttcccacagtcag
atcacacgcctgtacagccgcttcaccagcctggacaaaggggagaacggaactctcagc
cgggaagatttccagaggattccagaacttgccatcaacccactgggggaccggatcatc
aatgccttcttctcagagggagaggatcaggtaaacttccgaggattcatgagaactttg
gctcatttccgacccattgaggataacgaaaagagcaaagatgtgaatggaccggaaccc
ctcaacagccggagcaacaaactgcactttgctttcagactttatgacttggataaagat
gacaagatctcccgcgatgagctgttacaggtactgcgaatgatggtcggagtgaatatc
tcagatgagcagctgggcagtattgcagacaggaccatccaggaggctgaccaagatgga
gacagtgccatatcttttacagaatttgttaaggttttggagaaggtggatgtagaacag
aagatgagcatccgatttcttcactaaagggcagagaccaaattattcttgctttctagt
atttaagaactgaaacttccttctgtcctccagccccaccccatcctgtcatcccccttt
ccagaatactacagctcctgcatgacaacctgaagtctctcctgtccatacaaacttgcc
tttggtgtataaacagggcgttacagaatggtaccctgtctatttctgttcggtatccac
ccatcagtctttattgtaagtaccaacttcccctgttctactgctcagtgccacgcatcc
gtcctgtctgaggaaagaaacagggactcatgtcaagaaccagccagcaaagctcccact
agatgggaccatatccatgctgccttcccttcatcagccctccatcatggtcctgtgtgc
tgtgtcctgtgtcctgtgtctgtttcttcctacctctctgtcatccagccttctctcctc
agtctttcagctgtcctcctgtcgttgagattccctgcattctacttgactctgggctct
gctggtaagcctgtttctgatgtcgcaggatagttagtggtctggtgatctgtatcaacc
ttctgatgtgggatattgcctatccaggagctattgctctgtcgtcacagggcttatgag
cagacatgttcttaaaaggtagtcatggtgaggcttgtagagccatgtctcctaggtggc
ttcccaggtctctctacctctgactttttattttcaaatatatttatttggcttttctgg
gtacagtgttgacattcagaaaatagtctaatgcctgccagtttgcttctctttgggaca
ttgtcaccacccaagcggctgttctgacaatatggtagagggccttcttgtgttttctga
caaggatgggcaccctggagagctgcccacatttgctccacagcatgggttatgcctcag
tgttctgtacacttgaagattcttcacatttccaaacagaaagactagtgttacagaagt
gcctgacttacctcagtcctaaagaattagattgtcctcagtgtcttaaagttttgcaca
aaactctgaatgaattttatacttggcaaattttaatgctggaagatgtatagtcagttc
ataatcctggtccaggcactgtatgcattgaatgtattgtctcatgagcttcctaatgac
acgaccttcctagctccttgtgaatactatactatgcagatcccttagaagcatgggacc
tgggactggtggcaccaactgaggtgacattctctgccaatgtcagcttgatttagatgt
cactgaatcaagctgcttccgccctgtgttcctgtgaatctgctcttggctggctttctc
tggtgttgcctgcttgcttgcttgctttgttgctttggaaggctatccaagatatgtaag
caattctttaggaaataaattgctgttaacccaaacaaacaaaaacactgcagacgagat
gggtaaaggtgagcagtgggggcgtggctaggacagatggctagggtctacatgaactgg
ggaattctttatgaaatatgtcagactttgtgatcaaatgatgtgatataagaattgtat
aaagggaataattgtctgatacttatctgtttgagaagtacttcagaagcatcttgattt
aattatttaaagtttctaagattatgccccccttggctgtatagcaaactgtttttatcc
acagttgtgccttattgtcccattaaaattgtattcctcaatccaccaataaattaattg
tcattaaaacaaaaaaaaaaa

DBGET integrated database retrieval system