KEGG   Rhodobacter sphaeroides 2.4.1: RSP_0331Help
Entry
RSP_0331          gene      T00284                                 

Definition
pseudogene
Organism
rsp  Rhodobacter sphaeroides 2.4.1
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
JGI: 
Position
1:complement(2058388..2059383)
Genome map
NT seq 996 nt NT seq  +upstreamnt  +downstreamnt
atgaggagacggaccatcctgacatcggccgccgccgcgctgatgctggcccctgcagga
cgcctcctcgcgcagtcgggcagagaggctttgcctgcggaccacccgctccaggcggcc
tggcgcagctggaaggatgcgttcctgctgcccgccggccgcatcgtcgacgggccgcag
cagaatgcgagccattccgaagggcagggctacggagccacgctcgccgcgatcttcggc
gacgaggaggccctgcggcgcatcgtcgactggaccgaggcgaaccttgcgcggcgcgag
gacaagcttctgagctggcgctggctgcccggtgtggcgctggccgtgcccgacgagaac
aacgccaccgacggcgatctcttctacgcctggggtctcgccatggccgcgcagcggttc
ggcaaggccgattacgccgggcgggcgaccgaactggcgcgcgccatcgcgctgcattgc
gtgcgtccgcatccggacggctccgagcagctcgtgctgctgccgggggccagcggcttc
gagacgccggacggggtggtgctcaacccctcctactacatgccccgcgccctgaccgag
ctcgccgccttcagcggccaggaccggctggcgcgctgtgcccgcgacggggcggactgg
atcgcgtcgctcgggcttccgccggactgggcgctggtcacgcccttcggcacacagccg
gcgccgggcctgtcccacaacagcggctacgatgcgctgcgggtgcccctgttcctgctc
tggtccgggctgaccgccaatcccgcgctgcgccgcgcggtggaggcggccggggacgcc
gcagccggcgacacgccggtgaggttcgaccgcgacacgggggcggtgctggaacggtcc
gccgatccgggcttccgcgccgtgctcgcgcttggcgattgcgccctttcgggtcgtccg
ggggcggcgatcccgcccttcgacgcgcgccaaccg

DBGET integrated database retrieval system