KEGG   Rhodobacter sphaeroides 2.4.1: RSP_6177Help
Entry
RSP_6177          gene      T00284                                 

Gene name
gpFI
Definition
(RefSeq) pseudogene
Organism
rsp  Rhodobacter sphaeroides 2.4.1
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
2:418521..418652
Genome map
NT seq 132 nt NT seq  +upstreamnt  +downstreamnt
atgaaggccgggaagctctttctcgacttcgacatcgagccgcccgcgccgctggagcac
ctgacgctccaggcgcatcgcaacggcgactattacgaagagctcgtgctctcggtcacc
ggcaaccggtaa

DBGET integrated database retrieval system