KEGG   Salinispora arenicola: Sare_2430Help
Entry
Sare_2430         gene      T00613                                 

Definition
(GenBank) pseudogene
Organism
saq  Salinispora arenicola
SSDB OrthologParalogGene clusterGFIT
Position
complement(2792926..2793143)
Genome map
NT seq 218 nt NT seq  +upstreamnt  +downstreamnt
atgctcacggcggtgatgcggcacctggaggccaaggcgatcgacgaggccccggacctg
ttccaggttctgatgaccactcgactgatcaacacggccaagcggccacggacaaggaac
acctcttgacactgccgcagctggagaaggcgtcgcgcacgctcgcgcgggcggcgaagg
tgctgttcggggaactgaagctggtcgagacgtacggc

DBGET integrated database retrieval system