KEGG   Salinispora arenicola: Sare_R0034Help
Entry
Sare_R0034        tRNA      T00613                                 

Definition
(GenBank) tRNA-Lys
  KO
K14229  
tRNA Lys
Organism
saq  Salinispora arenicola
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:saq00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Sare_R0034
Non-coding RNAs [BR:saq03100]
 Transfer RNA
  tRNA
   Sare_R0034
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
2815067..2815140
Genome map
NT seq 74 nt NT seq  +upstreamnt  +downstreamnt
acaccggtgaggcggccggcggtggcggactcttaatccgcgggttcggggttcgagtcc
ctggcggcgcacca

DBGET integrated database retrieval system