KEGG   Shewanella amazonensis: Sama_0681Help
Entry
Sama_0681         CDS       T00445                                 

Definition
(GenBank) malate synthase
  KO
K01638  malate synthase [EC:2.3.3.9]
Organism
saz  Shewanella amazonensis
Pathway
saz00620  Pyruvate metabolism
saz00630  Glyoxylate and dicarboxylate metabolism
saz01100  Metabolic pathways
saz01110  Biosynthesis of secondary metabolites
saz01120  Microbial metabolism in diverse environments
saz01200  Carbon metabolism
Module
saz_M00012  Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:saz00001]
 Metabolism
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    Sama_0681
   00630 Glyoxylate and dicarboxylate metabolism
    Sama_0681
Enzymes [BR:saz01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     Sama_0681
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ABL98889
JGI: Sama0681
UniProt: A1S3D3
Position
842929..843501
Genome map
AA seq 190 aa AA seqDB search
MNMTMMNTQNQQQLHHFIGEAIAAVVNGAKRGVSLESATEFLDRRFPLARGSHKMVKSYV
VYYQHLLAFFEDGSHSGLETSSQFVALSGHKEEPCAILLKSGDIHVELTLDKNGRMGSAN
PAHIEDIQVESPGFCLRESEGCATEAISQCRNWLSLLHSAPCDDDCRQRNERRFTAKDGG
EYQLMSLGLF
NT seq 573 nt NT seq  +upstreamnt  +downstreamnt
atgaacatgaccatgatgaatacccaaaatcagcaacaactgcatcacttcatcggggaa
gccattgccgcagtggtgaatggtgccaaacggggagtcagtctcgagagtgcgaccgaa
tttcttgaccgccgctttccgctggcgcggggcagtcataagatggtgaaaagctatgtg
gtttactaccagcacctgctggccttctttgaagacggcagccacagtgggctggaaacc
tcttcccagtttgtagccctgagcggtcacaaggaagagccctgtgccatcctgctcaag
tcaggtgatattcatgtggagttaaccctggataagaatggccgcatgggcagtgccaat
ccggcccatatcgaggacattcaggttgagtcccccggcttttgcctgagagaaagcgaa
ggctgtgccacagaagccatcagccaatgccgcaactggttgagcctgctgcactcggct
ccctgcgatgatgattgccgtcagcgcaacgagcgtcgctttaccgcaaaagatggcggc
gagtatcagttgatgtcactgggactcttttaa

DBGET integrated database retrieval system