KEGG   Shewanella amazonensis: Sama_0681Help
Entry
Sama_0681         CDS       T00445                                 

Definition
(RefSeq) malate synthase
  KO
K01638  
malate synthase [EC:2.3.3.9]
Organism
saz  Shewanella amazonensis
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:saz00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    Sama_0681
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    Sama_0681
   00630 Glyoxylate and dicarboxylate metabolism
    Sama_0681
Enzymes [BR:saz01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     Sama_0681
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
JGI: 
UniProt: 
Position
842929..843501
Genome map
AA seq 190 aa AA seqDB search
MNMTMMNTQNQQQLHHFIGEAIAAVVNGAKRGVSLESATEFLDRRFPLARGSHKMVKSYV
VYYQHLLAFFEDGSHSGLETSSQFVALSGHKEEPCAILLKSGDIHVELTLDKNGRMGSAN
PAHIEDIQVESPGFCLRESEGCATEAISQCRNWLSLLHSAPCDDDCRQRNERRFTAKDGG
EYQLMSLGLF
NT seq 573 nt NT seq  +upstreamnt  +downstreamnt
atgaacatgaccatgatgaatacccaaaatcagcaacaactgcatcacttcatcggggaa
gccattgccgcagtggtgaatggtgccaaacggggagtcagtctcgagagtgcgaccgaa
tttcttgaccgccgctttccgctggcgcggggcagtcataagatggtgaaaagctatgtg
gtttactaccagcacctgctggccttctttgaagacggcagccacagtgggctggaaacc
tcttcccagtttgtagccctgagcggtcacaaggaagagccctgtgccatcctgctcaag
tcaggtgatattcatgtggagttaaccctggataagaatggccgcatgggcagtgccaat
ccggcccatatcgaggacattcaggttgagtcccccggcttttgcctgagagaaagcgaa
ggctgtgccacagaagccatcagccaatgccgcaactggttgagcctgctgcactcggct
ccctgcgatgatgattgccgtcagcgcaacgagcgtcgctttaccgcaaaagatggcggc
gagtatcagttgatgtcactgggactcttttaa

DBGET integrated database retrieval system