KEGG   Shewanella amazonensis: Sama_0681Help
Entry
Sama_0681         CDS       T00445                                 

Definition
malate synthase
Orthology
K01638  
malate synthase [EC:2.3.3.9]
Organism
saz  Shewanella amazonensis
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:saz00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    Sama_0681
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    Sama_0681
   00630 Glyoxylate and dicarboxylate metabolism
    Sama_0681
Enzymes [BR:saz01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     Sama_0681
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
JGI: 
UniProt: 
Position
842929..843501
Genome map
AA seq 190 aa AA seqDB search
MNMTMMNTQNQQQLHHFIGEAIAAVVNGAKRGVSLESATEFLDRRFPLARGSHKMVKSYV
VYYQHLLAFFEDGSHSGLETSSQFVALSGHKEEPCAILLKSGDIHVELTLDKNGRMGSAN
PAHIEDIQVESPGFCLRESEGCATEAISQCRNWLSLLHSAPCDDDCRQRNERRFTAKDGG
EYQLMSLGLF
NT seq 573 nt NT seq  +upstreamnt  +downstreamnt
atgaacatgaccatgatgaatacccaaaatcagcaacaactgcatcacttcatcggggaa
gccattgccgcagtggtgaatggtgccaaacggggagtcagtctcgagagtgcgaccgaa
tttcttgaccgccgctttccgctggcgcggggcagtcataagatggtgaaaagctatgtg
gtttactaccagcacctgctggccttctttgaagacggcagccacagtgggctggaaacc
tcttcccagtttgtagccctgagcggtcacaaggaagagccctgtgccatcctgctcaag
tcaggtgatattcatgtggagttaaccctggataagaatggccgcatgggcagtgccaat
ccggcccatatcgaggacattcaggttgagtcccccggcttttgcctgagagaaagcgaa
ggctgtgccacagaagccatcagccaatgccgcaactggttgagcctgctgcactcggct
ccctgcgatgatgattgccgtcagcgcaacgagcgtcgctttaccgcaaaagatggcggc
gagtatcagttgatgtcactgggactcttttaa

DBGET integrated database retrieval system