KEGG   Shewanella amazonensis: Sama_R0078Help
Entry
Sama_R0078        tRNA      T00445                                 

Definition
(GenBank) tRNA-Asp
  KO
K14221  
tRNA Asp
Organism
saz  Shewanella amazonensis
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:saz00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Sama_R0078
Non-coding RNAs [BR:saz03100]
 Transfer RNA
  tRNA
   Sama_R0078
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(2294530..2294606)
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
ggagcggtagttcagttggttagaataccggcctgtcacgccgggggtcgcgggttcgag
tcccgtccgctccgcca

DBGET integrated database retrieval system