KEGG   Shigella boydii CDC 3083-94: SbBS512_E1549Help
Entry
SbBS512_E1549     CDS       T00700                                 

Definition
putative sucrose phosphorylase
Orthology
K00690  
sucrose phosphorylase [EC:2.4.1.7]
Organism
sbc  Shigella boydii CDC 3083-94
Pathway
Starch and sucrose metabolism
Brite
KEGG Orthology (KO) [BR:sbc00001]
 Metabolism
  Carbohydrate metabolism
   00500 Starch and sucrose metabolism
    SbBS512_E1549
Enzymes [BR:sbc01000]
 2. Transferases
  2.4  Glycosyltransferases
   2.4.1  Hexosyltransferases
    2.4.1.7  sucrose phosphorylase
     SbBS512_E1549
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
1412501..1412926
Genome map
AA seq 141 aa AA seqDB search
MESLPRNDYAGVEKLGYNRAINRKKYHSKEITRELNDEATLRHAVYHELSRLITPRRSHN
EFHPDNNFTIDTINSSVMRIQRSNADGNCLTGLFNVSKNIQHVNITNLHGRDLISEVDIL
GNEITLRPWQVMWIKVMTPNY
NT seq 426 nt NT seq  +upstreamnt  +downstreamnt
ttggagtcattaccgcgtaatgattacgcaggtgtcgaaaaactcggatataaccgtgcg
attaaccgtaaaaaatatcacagtaaagagataacccgagaactgaacgatgaagctaca
ttaaggcatgcggtatatcatgagttgtcgcgtttaattacacctcgtcgcagccataac
gagtttcatccggataataattttaccatcgatacgattaattcatccgtaatgcgtatt
caaagaagtaacgctgatggtaattgtctgactggattgtttaatgtcagtaaaaatatt
cagcatgtaaatattactaatctgcatggtcgggatctgattagtgaagttgatatattg
ggtaatgaaataacgctgcgcccctggcaggttatgtggattaaggtaatgactccaaat
tattga

DBGET integrated database retrieval system