KEGG   Shewanella baltica OS185: Shew185_4295Help
Entry
Shew185_4295      CDS       T00571                                 

Definition
malate synthase
Orthology
K01638  
malate synthase [EC:2.3.3.9]
Organism
sbm  Shewanella baltica OS185
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:sbm00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    Shew185_4295
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    Shew185_4295
   00630 Glyoxylate and dicarboxylate metabolism
    Shew185_4295
Enzymes [BR:sbm01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     Shew185_4295
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
JGI: 
UniProt: 
Position
5126955..5127518
Genome map
AA seq 187 aa AA seqDB search
MNMSIIKSNQIQPNLNSLIAEEVLAVAQVNVAEHEKIANAKQFLDRLFPLNSGSHQDVSS
YVVYYQHLLAFFADGSHSGLRQPKQFVAFNGTKDAPCAIVLQDLGCHVELSFDRNGMIGA
RDVANLEDIQIETSLNMVVGTPESRSAASRHWLSLLHAGMSSANDTQDKLFTAKDGSDYN
LKSIVNL
NT seq 564 nt NT seq  +upstreamnt  +downstreamnt
atgaatatgtcaattatcaagagcaaccagatccaaccgaatctaaacagcctcatcgca
gaagaagtgctagccgtggcccaagtgaatgtcgccgagcacgaaaagatcgccaatgcg
aaacaattcctcgaccgcctctttccactcaactctggttcacaccaagatgtgagcagc
tatgtggtttactaccaacacctgctggctttttttgccgacggcagccacagcggttta
cgtcagccaaaacagttcgtggcttttaacggcactaaagatgcgccttgcgccatagtg
ttacaggacctaggttgccacgttgaactcagtttcgaccgcaatggcatgataggggcg
agagacgttgccaatctggaagatatccaaatcgaaacgtcattaaacatggttgtcgga
acaccagagtcacgttcagccgcatcgcgccattggctcagcctgttacatgcgggtatg
tccagcgctaacgacacccaagataagttgtttaccgcaaaggatggcagcgattacaac
ttgaaaagtatcgtaaatttataa

DBGET integrated database retrieval system