KEGG   Saccharomyces cerevisiae (budding yeast): YJR151W-AHelp
Entry
YJR151W-A         CDS       T00005                                 

Definition
hypothetical protein
Organism
sce  Saccharomyces cerevisiae (budding yeast)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
SGD: 
MIPS: 
UniProt: 
Position
X:717580..717630
Genome map
AA seq 16 aa AA seqDB search
MLSLIFYLRFPSYIRG
NT seq 51 nt NT seq  +upstreamnt  +downstreamnt
atgctatcgttaatcttttaccttcgtttcccatcttatataaggggatga

DBGET integrated database retrieval system