KEGG   Shewanella denitrificans: Sden_0217Help
Entry
Sden_0217         CDS       T00344                                 

Definition
(RefSeq) malate synthase (EC:2.3.3.9)
  KO
K01638  
malate synthase [EC:2.3.3.9]
Organism
sdn  Shewanella denitrificans
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:sdn00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    Sden_0217
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    Sden_0217
   00630 Glyoxylate and dicarboxylate metabolism
    Sden_0217
Enzymes [BR:sdn01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     Sden_0217
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
JGI: 
UniProt: 
Position
complement(236607..237116)
Genome map
AA seq 169 aa AA seqDB search
MNMSLMNNVQTNQYLDSNTETNNVAALTQGVVATSTPSAKAKQFLDRHFPLSQGSHLEVM
SYLVYYTHLIAFMADGSQSGLKRPRQFVALSGHKSEPSCLVLKDGKTHLAINIDRQGPLG
SQDLAGVNDVLLQTMPHTKLTQEWTSLLNQDMLTRPLSVTAKDGSDYCL
NT seq 510 nt NT seq  +upstreamnt  +downstreamnt
atgaatatgtcattaatgaataacgttcagactaatcaataccttgactctaatacagag
acaaacaacgtcgctgccttaactcagggtgtggtggcaacgtcaacgccgagtgcaaaa
gcaaaacaattcctcgaccgccacttcccactttcacaaggttcgcacctagaagtgatg
agttacttagtgtattacactcacctgattgcctttatggccgatggcagccaaagtggc
cttaaacgtcctcgccaatttgtggcattaagtggtcacaagagcgagccaagctgccta
gtattaaaagatggtaaaactcaccttgccatcaatattgaccgacagggcccgttaggt
agtcaagatctggctggcgtcaatgatgtattactgcagaccatgccacataccaagctc
actcaagaatggaccagcctgcttaaccaagacatgcttactaggccattaagtgtgacg
gctaaagatggcagtgattactgcctataa

DBGET integrated database retrieval system