KEGG   Shigella dysenteriae Sd197: SDY_0378Help
Entry
SDY_0378          gene      T00306                                 

Gene name
lacZ
Definition
pseudogene
Organism
sdy  Shigella dysenteriae Sd197
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
ShiBASE_China: 
Position
complement(362065..365140)
Genome map
NT seq 3076 nt NT seq  +upstreamnt  +downstreamnt
atgactatgattacggattcactggccgtcgtattacaacgtcgtgactgggaaaaccct
ggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagc
gaagaggcccgcaccaatcgcccttcccaacagttgcgcagcctgaatggtgagtggcaa
tttgtcttggtttccggcaccagaagcggttccggaaagctggctggagtgcgatcttcc
tgtcgccgatactgtcgtcgtcccctcaaactggcagatgcacggttacgacgcgcccat
ctacaccaacgtgacctatcccattacggtcaatccgccatttgttcccacagagaatcc
gacgggttattactcgctcacatttaatgttgatgaaagctggctacaggaaggccagac
gcgaattatttttgatggcgttaactcggcgtttcatctgtggtgcaacgggcgctgggt
cggttacggccaggacagtcgtttgccgtctgaatttgacctgagcgcatttttacgcgc
cggagaaaaccgcctcgcggtgatggtgctgcgctggagtgacggcagttatctggaaga
tcaggatatgtggcggatgagcggcattttccgtgacgtctcgttgctgcacaaaccgac
cacacaaatccgcgatttccatgttgccactcgctttaatgatgatttcagccgcgcggt
actggaggcagaagttcagatgtacggcgagctgcgcgatgagctgcgggtgacggtttc
tttgtggcagggtgaaacgcaggtcgccagcggcaccgcgcctttcggcggtgaaattat
ccatgagcgtggcggttatgccgatcgcgtcacactaggtctgaacgtcgaaaacccgaa
actgtggagcgccgaaatcccgaatatctatcgtgcggtggttgaactgcacaccgccga
cggcacgctgattgaagcagaagcctgcgatgtcggtttccgcgaggtgcggattgaaaa
tggtctgctgctgctgaacggcaagccgttgctgattcgcggcgttaaccgtcacgagca
tcatcctctgcatggtcaggtcatggatgagcagacgatggtgcaggatatcctgctgat
gaagcagaataactttaacgccgtgcgctgttcgcattatccgaaccatccgctgtggta
cacgctgtgcgaccgctacggcctgtatgtggtggatgaagccaacattgaaacccacgg
catggtgccaatgaatcgtctgaccgatgatccgcgctggctacccgcgatgagcgaacg
cgtaacgcgaatggtgcagcgcgatcgtaatcacccgagtgtgatcatctggtcgctggg
aaatgagtcaggccacggcgctaatcacgacgcactctatcgctggatcaaatctgtcga
tccttcccgcccggtacagtatgaaggcggcggagccgacacctccgcaaccgatattat
ttgcccgatgtacgcgcgcgtggatgaagaccagctcttcccggctgtgccgaaatggtc
catcaaaaaatggctttcgttgcctggagagacgcgcccgctgatcctttgcgaatacgc
ccacgcgatgggtaacagtcttggcggcttcgcgaaatactggcaggcgtttcgtcagta
cccccgtttacagggtggcttcgtttgggactgggtggatcagtcgctgattaaatatga
tgaaaacggcaacccgtggtcggcttacggcggtgattttggcgatacgccgaatgatcg
ccagttctgcatgaacggtctggtctttgccgaccgcacgccgcatccggcgctgacgga
agcaaaacaccagcagcagtttttccagttccgtttatccgggcgaaccatcgaagtgac
cagcgaatacctgttccgtcagagcgataacgagctcctgcactggacggtggcactgga
tggcaagccgctggcaagcagtgaagtacctatgaatgtcgctccacaaggtaaacaggt
aattgaattgcctgaactaccgcgactggagagcaccgggcaactctggctaacggtaca
cgtagtgcaaccgaacgcgaccgcatggtcagaagccggacacatcagcgcctggcagca
gtggcgtctggcggcaaacctcagcgtgacactcccctccgcgccccacgccatcccgca
actgaccaccagcgaaacggatttttgcatcgagctggataataagcgttggcaatttaa
ccgccagtcaggctttctttcacagatgtggattggcgatgaaaaacaactgctgacgcc
gctgcgcgatcagttcacccgtgcaccgctggataacgacattggcgtaagtgaagcgac
ccgcattgaccctaacgcctgggtcgaacgctggaaggcggcgggccattaccaggccga
agcagcgttgttgcagtgcacggcagatacacttgccgacgcggtgctgattacgaccgc
tcacacgtggcagcatcagggaaaaaccttatttatcagccggaaaacctaccggattga
tggaagtggtcaaatggcgattaccgttgatgttgaagtagcgagcgatacaccgcatcc
ggcacggattggcctgacctgccagctggcgcaggttgcagagcgggtaaactggctcgg
attagggccgcaagaaaactatcccgaccgccttactgcggcctgttttgaccgctggga
tctgccattgtcagacatgtataccccgtacgtcttcccgagcgaaaacggtctgcgctg
tgggacgcgcgaattgaattatggcccacaccagtggcgcggcgacttccagttcaatat
cagtcgctacagccaacaacaactgatggaaaccagccatcgccatctgctgcacgcgga
agaaggcacatggctgaatatcgacggtttccatatggggattggtggcgacgactcctg
gagcccgtcagtgtcggcggaattccagctgagcgccggtcgctaccattaccagttggt
ctggtgtcaaaaataa

DBGET integrated database retrieval system