KEGG   Salmonella enterica subsp. enterica serovar Dublin: SeD_A0849Help
Entry
SeD_A0849         tRNA      T00757                                 

Definition
(GenBank) tRNA-Lys
  KO
K14229  tRNA Lys
Organism
sed  Salmonella enterica subsp. enterica serovar Dublin
Pathway
sed00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:sed00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    SeD_A0849
Non-coding RNAs [BR:sed03100]
 Transfer RNA
  tRNA
   SeD_A0849
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
843831..843908
Genome map
NT seq 78 nt NT seq  +upstreamnt  +downstreamnt
tgggtcgttagctcagttggtagagcagttgacttttaatcaattggtcgcaggttcgaa
tcctgcacgacccaccaa

DBGET integrated database retrieval system