KEGG   Salmonella enterica subsp. enterica serovar Dublin: SeD_A0959Help
Entry
SeD_A0959         gene      T00757                                 

Definition
(GenBank) pseudogene
Organism
sed  Salmonella enterica subsp. enterica serovar Dublin
SSDB OrthologParalogGene clusterGFIT
Position
952585..952782
Genome map
NT seq 198 nt NT seq  +upstreamnt  +downstreamnt
atgcaatatactgatattcaaatttggcagcctggcattctgcgcaacaccgattatctt
aaccccggtcccgctaagctgctggccgccactctggataaagacatcaaaatctttaaa
gagggggggcgttctgccagaattatggcactggctctattttcttcctgtcgaccgcca
gtcagatctatctgctga

DBGET integrated database retrieval system