KEGG   Secondary endosymbiont of Heteropsylla cubana: A35E_00077Help
Entry
A35E_00077        CDS       T02336                                 

Definition
(GenBank) hypothetical protein
Organism
sehc  Secondary endosymbiont of Heteropsylla cubana
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AFP85399
UniProt: J3Z535
Position
155769..155987
Genome map
AA seq 72 aa AA seqDB search
MKYIKEELAERRNLLLESGKIIEEQRLVQRIACDSKMMNELGYYSEMENYSHYLSAREEN
NPPTNSICLFSE
NT seq 219 nt NT seq  +upstreamnt  +downstreamnt
atgaagtatatcaaagaagaattagccgaacggcgtaacttattattagaatccggaaaa
ataatagaagagcaacggcttgtacagcgtattgcctgtgattcgaaaatgatgaatgag
ttaggctattactctgaaatggaaaattactcccattatctatccgctcgcgaggaaaac
aaccctcctaccaactctatttgcttattttccgaataa

DBGET integrated database retrieval system