KEGG   Secondary endosymbiont of Heteropsylla cubana: A35E_00092Help
Entry
A35E_00092        tRNA      T02336                                 

Definition
(GenBank) tRNA-Ala
  KO
K14218  
tRNA Ala
Organism
sehc  Secondary endosymbiont of Heteropsylla cubana
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:sehc00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    A35E_00092
Non-coding RNAs [BR:sehc03100]
 Transfer RNA
  tRNA
   A35E_00092
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
175809..175884
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
ggggctatagctcaattggtagagcgcctgctttgcacgcaggaggttagcggttcaatt
ccgcttagctccacaa

DBGET integrated database retrieval system