KEGG   Saccharopolyspora erythraea: SACE_4785Help
Entry
SACE_4785         CDS       T00492                                 

Definition
glycosyl hydrolase (EC:3.2.1.45)
Orthology
K01201  
glucosylceramidase [EC:3.2.1.45]
Organism
sen  Saccharopolyspora erythraea
Pathway
Other glycan degradation
Sphingolipid metabolism
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:sen00001]
 Metabolism
  Lipid metabolism
   00600 Sphingolipid metabolism
    SACE_4785
  Glycan biosynthesis and metabolism
   00511 Other glycan degradation
    SACE_4785
Enzymes [BR:sen01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.45  glucosylceramidase
     SACE_4785
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
Cambridge: 
Kitasato: 
UniProt: 
Position
5350098..5350475
Genome map
AA seq 125 aa AA seqDB search
MTGGPVSVLAVERMGQPVPVGDQAAHRGGIAAGRIPQYGSEMSGGTWVGNQHFDDMNNII
DCTRNRGRTVNEWSLALDQNHNPHNGGCDVCTGLVTVHNGDHRHGDLHVERHTRRVTAQR
RMSRR
NT seq 378 nt NT seq  +upstreamnt  +downstreamnt
atgaccggtggcccggtgtcagtcctcgccgtggaacggatgggtcagccggtcccggtc
ggcgaccaggcggcgcaccgcggcgggatcgcggccggtcgcatcccgcagtacggcagc
gagatgtccggcggcacctgggtcggcaaccagcacttcgacgacatgaacaacatcatc
gactgcacccggaaccggggtcgcaccgtcaatgagtggagcctggcgctcgaccagaac
cacaacccgcacaacggcggctgcgacgtctgcaccggcctggtcaccgtccacaacgga
gaccaccggcacggcgacctccacgtggaacggcacacccggcgcgtgaccgcacagcgg
cggatgtcgcgccgctga

DBGET integrated database retrieval system