KEGG   Staphylococcus epidermidis ATCC 12228: SE0059Help
Entry
SE0059            CDS       T00110                                 

Definition
cassette chromosome recombinase A
Organism
sep  Staphylococcus epidermidis ATCC 12228
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
62622..62741
Genome map
AA seq 39 aa AA seqDB search
MLYRYIDEIHISKNKSLVGIYFKNEPLNIVNQATQSSIA
NT seq 120 nt NT seq  +upstreamnt  +downstreamnt
atgttataccgatatattgatgaaattcatatttctaaaaacaaaagccttgtgggaatc
tatttcaaaaatgaaccgctaaacattgtaaaccaagctacgcaatcatcgattgcttaa

DBGET integrated database retrieval system