KEGG   Staphylococcus epidermidis ATCC 12228: SE1319Help
Entry
SE1319            CDS       T00110                                 

Definition
transposase
Organism
sep  Staphylococcus epidermidis ATCC 12228
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
1350920..1351036
Genome map
AA seq 38 aa AA seqDB search
MEISVLIPTHDISRHVNDIVEIIPDTEFDEFRHHRGLI
NT seq 117 nt NT seq  +upstreamnt  +downstreamnt
atggaaatttcagttcttatccccacacatgatatttcacgacatgtaaatgatattgta
gaaataattccagatacagaattcgatgaattcagacatcatcgtggcttaatataa

DBGET integrated database retrieval system