KEGG   Staphylococcus epidermidis ATCC 12228: SE2078Help
Entry
SE2078            CDS       T00110                                 

Definition
transposase
Organism
sep  Staphylococcus epidermidis ATCC 12228
Class
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
2123720..2123827
Genome map
AA seq 35 aa AA seqDB search
METSVLIPTNDISRHVNDIAETIPDTEFRYHRGLI
NT seq 108 nt NT seq  +upstreamnt  +downstreamnt
atggaaacttcagttcttatccccacaaatgatatttcacgacatgtaaatgatattgca
gaaacaattcccgatactgaattcagatatcatcgtggcttaatataa

DBGET integrated database retrieval system