KEGG   Staphylococcus epidermidis RP62A: SERP0369Help
Entry
SERP0369          CDS       T00229                                 

Definition
(GenBank) IS1272-like transposase, degenerate
Organism
ser  Staphylococcus epidermidis RP62A
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
complement(367730..367885)
Genome map
AA seq 51 aa AA seqDB search
MCKEYNMTQHTLPMESSVLIPTNNISRHVNDIVETIPDTEFDEFSHHRGLI
NT seq 156 nt NT seq  +upstreamnt  +downstreamnt
atgtgtaaagaatataacatgactcaacatactctaccaatggaaagttcagttcttatc
cctacaaataatatttcacgacatgtaaatgatattgtagaaacaattcccgatactgaa
ttcgatgaattcagtcatcatcgtggcttaatataa

DBGET integrated database retrieval system