KEGG   Staphylococcus epidermidis RP62A: SERP2167Help
Entry
SERP2167          CDS       T00229                                 

Definition
(GenBank) lipoprotein, putative
Organism
ser  Staphylococcus epidermidis RP62A
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
complement(2195581..2196504)
Genome map
AA seq 307 aa AA seqDB search
MKKFWGILLIVMSIALVGCSNSNDSDQSSNEKSSSKSSENKTDVATEYTKEDEYKELEKE
AKDHKQKPVLNEIDALITEKGFTNKTGLQGWKDYKKLMDKVTLADYKYTKESKGSSIEEV
NKFFKDKKGVEIKRMKSKEKNIKHINYMYVDPDGKKAGKDKQPMSYAQILATFKEGKLVA
TNIQPGFFALDKKKMVKAKDLEEVKTLEDLTRLKNPKATSYGILQTKYKGKPYTQVSILG
SDSDEENDISSAILAYYLFSPTELDSDDNHKYVEVASAPFISAQNDFSSYQLGVFKKIIE
SSMSFDE
NT seq 924 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaaattttggggaattttattaattgtgatgtcaattgctcttgtgggatgttcg
aatagcaatgattcagatcaatcttctaatgaaaagtcatcatcaaaaagttcggagaat
aaaacggacgtggcgactgaatatacaaaagaggacgaatataaagaactagaaaaagaa
gctaaggatcataaacaaaagccagttcttaatgaaatcgatgcacttattacagaaaaa
ggttttaccaacaaaacaggattgcaaggctggaaagactataaaaaattaatggataag
gtaacacttgcagattataaatacacaaaagaatctaaaggatcatcaattgaagaagtt
aataagttctttaaagataaaaaaggtgtagagattaaacgaatgaaaagtaaggaaaaa
aatattaagcatatcaattatatgtatgtagatccagatggtaaaaaagcaggtaaagat
aagcaacctatgtcctacgctcaaatacttgcaacatttaaagaaggtaaattagtagct
acaaatattcaacctggattttttgctttagataaaaagaaaatggttaaagctaaagac
ttagaagaagttaagacattggaagatttaacacgtttgaaaaatcctaaagcgacatca
tatggtattttacagacgaaatataaagggaaaccatacactcaagtttcaatattaggc
agtgattctgatgaagagaatgatatttcctcagccatattagcttattatctattttca
ccaacggaattagatagtgacgataatcataaatacgttgaagttgcatcagcaccattc
ataagtgctcaaaacgatttttcatcttatcaactaggtgtatttaaaaaaattatcgaa
agtagtatgtcgttcgatgaataa

DBGET integrated database retrieval system