KEGG   Staphylococcus epidermidis RP62A: SERP2229Help
Entry
SERP2229          gene      T00229                                 

Definition
(GenBank) pseudogene
Organism
ser  Staphylococcus epidermidis RP62A
SSDB OrthologParalogGene clusterGFIT
Position
complement(2261247..2261482)
Genome map
NT seq 236 nt NT seq  +upstreamnt  +downstreamnt
atgcgccaaataaagatattgatttggagcgttcccatgaaaatattacgctcaaaaatt
gtgaaaccaaaaaataagcataagtcagatattcaatctcccgttgatgaaacggaaaat
atccaataaaagatacagattatatgacagatgatgaggaaaaagcagatgaggaagctt
ttagtattattgctttctggaactgggaacgtaggaattattttattaaaaaatag

DBGET integrated database retrieval system