KEGG   Shewanella halifaxensis: Shal_2296Help
Entry
Shal_2296         CDS       T00654                                 

Definition
(RefSeq) malate synthase
  KO
K01638  
malate synthase [EC:2.3.3.9]
Organism
shl  Shewanella halifaxensis
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:shl00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    Shal_2296
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    Shal_2296
   00630 Glyoxylate and dicarboxylate metabolism
    Shal_2296
Enzymes [BR:shl01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     Shal_2296
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GI: 
NCBI-GeneID: 
JGI: 
UniProt: 
Position
complement(2781498..2782013)
Genome map
AA seq 171 aa AA seqDB search
MNISTINSTQVNQNNHFIGASLVDVNVVELAASNTTAPCAKAFLDAKFPLANGSHKNARS
YVVYYQQLLIFMADGTQTGLRTPKQFVALNGHKSEPTAILLKDNGTHVELSFDRKNEATS
QDLANIRDIQLEGHDYWISLINIEDTATTSVMQKRTREFTAKDGSDYQLKS
NT seq 516 nt NT seq  +upstreamnt  +downstreamnt
atgaatatatcaacaatcaatagtactcaagtaaatcaaaataaccatttcattggtgcc
agccttgttgatgtgaatgttgtcgaactggcagctagcaatacaacggccccctgtgca
aaagcatttttagatgcaaagtttccattggctaacggctcacataaaaatgcccgtagc
tatgtagtttactatcagcaactgttgatctttatggccgatggcacacagacgggtttg
cgtacgcctaagcagtttgtggctctgaacggccataagagtgagcctacagctatctta
ttaaaagataatggtactcatgtagaattaagttttgatagaaagaatgaggcgaccagt
caggacttagcaaacattagggatatccagcttgaaggccacgattattggataagccta
attaatattgaagatacagccactacctccgtaatgcaaaaacgaacgcgcgaatttacg
gcaaaagatggcagtgattatcagcttaaaagctaa

DBGET integrated database retrieval system