KEGG   Shewanella sp. MR-7: Shewmr7_R0121Help
Entry
Shewmr7_R0121     rRNA      T00389                                 

Definition
(GenBank) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
shm  Shewanella sp. MR-7
Pathway
shm03010  Ribosome
Brite
KEGG Orthology (KO) [BR:shm00001]
 Genetic Information Processing
  Translation
   03010 Ribosome
    Shewmr7_R0121
Ribosome [BR:shm03011]
 Ribosomal RNAs
  Prokaryotes
   Shewmr7_R0121
Non-coding RNAs [BR:shm03100]
 Ribosomal RNA
  Large subunit rRNA
   Shewmr7_R0121
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(3641000..3641115)
Genome map
NT seq 116 nt NT seq  +upstreamnt  +downstreamnt
cttggtgacaatagcattgtggtcccacctgatcccatcccgaactcagaagtgaaacgc
aatcgcgccgatggtagtgtggggtctccccatgtgagagtaggtcatcgccaagc

DBGET integrated database retrieval system