KEGG   Sarcophilus harrisii (Tasmanian devil): 100917717Help
Entry
100917717         misc_RNA  T02286                                 

Gene name
CHKA
Definition
(RefSeq) uncharacterized LOC100917717
Organism
shr  Sarcophilus harrisii (Tasmanian devil)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
Position
6
NT seq 733 nt NT seq  +upstreamnt  +downstreamnt
cctctgctccttacctgactgtgtccaatctgtctcagatgagccccggaaagtgcttct
gcgcctgtatggtgccattctgcagatggcttgcccatgcgatcgtgcctagagcactct
ggtttccaggtgacagacacgattcacggagcaccattaggtaaggcaaaggggcttctt
ccattggcagagtaaccctttaactgtgtcacccccgagaagatacagctcttgttataa
cagtgaggtaatgaccgtagctctctttagaatttgtacacaggtcaaatcccgttacaa
caccttggaggcagagaggccgagagctcttggcttagcttttctggaggggtggggggg
tggccctggagggaggggcatggagcagggtgcaccccctggtgctcttgggcagaggct
cggggtcactcgactcgagcgtcccgagcgctcgcccagctgctcggcctgacttggaag
cattgccctagctcccctagcatcttcccctgcctcccatcccctacaggggtgcccgat
gccagagcctggcggcgtggaagctgcctgggccttgccctctaaaagcagaatctagct
ggaggggagaggtttccttgtgggacgtttggagtcgagttctaagacagtagatgctag
ctaacatttataatgtttctttaaggtttgcaaaatgctttacacacattctaacttgac
cctcacaacaact

DBGET integrated database retrieval system