KEGG   Spirosoma linguale: Slin_3368Help
Entry
Slin_3368         gene      T01156                                 

Definition
(GenBank) pseudogene
Organism
sli  Spirosoma linguale
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
4071095..4071364
Genome map
NT seq 270 nt NT seq  +upstreamnt  +downstreamnt
tttccgggtggtcagcaggcactacagacgtacctgaacgatctcaccccatcaaacgct
gaccgacaggaagggaccgttcacatccagtttcgggtaatgcccacgggtcacctgacg
gaaattaaagtagtgcgctcaaccgaatcgatgctgaataaggttgccatgcaggcggtt
gcccaaatgccacgctggtatccggcgcaccggtctggcgttgcggtaagcagcctgtat
gtgttaccaatcacctttcgttcccgataa

DBGET integrated database retrieval system