KEGG   Sinorhizobium medicae: Smed_4455Help
Entry
Smed_4455         gene      T00555                                 

Definition
(RefSeq) pseudogene
Organism
smd  Sinorhizobium medicae
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 5318607
Position
pSMED01:complement(939471..939657)
Genome map
NT seq 187 nt NT seq  +upstreamnt  +downstreamnt
cccctcgacgtccaagccctcctgttcatcaatcagcatcctgaatgcagcttggggagg
ttgcccgggcttcccggttgcactgacgacgatgtcttcttcggccggtccgttggtccc
tcgggatcgaacgccagcggccagaggttatcggcggtcggtggctctgccgactacgct
gaagggc

DBGET integrated database retrieval system