KEGG   Sinorhizobium meliloti GR4: C770_GR4pD1531Help
Entry
C770_GR4pD1531    ncRNA     T02405                                 

Definition
(GenBank) Group II catalytic intron D1-D4-2
Organism
smeg  Sinorhizobium meliloti GR4
SSDB OrthologParalogGene clusterGFIT
Position
pRmeGR4d:1678695..1678816
Genome map
NT seq 122 nt NT seq  +upstreamnt  +downstreamnt
gagggtaggcccctcgggatcggctttcaggagcgggtctcaaaccagcccaagctgctg
tggtagaagagccatggtggtgagcgttgggtcaaaagccgcggacatgatccggggcag
gt

DBGET integrated database retrieval system