KEGG   Sinorhizobium meliloti BL225C: SinmeB_4342Help
Entry
SinmeB_4342       gene      T01884                                 

Definition
(GenBank) pseudogene
Organism
smq  Sinorhizobium meliloti BL225C
SSDB OrthologParalogGene clusterGFIT
Position
pSINMEB02:complement(958984..959154)
Genome map
NT seq 171 nt NT seq  +upstreamnt  +downstreamnt
ttaggcctggttgcctggcccgtgagatatggcgttaccggggtgaagaccttcgtcgtc
aatcgcaacggcatcgtctacgaggcggatctcggcgaggacaccgagaagactgccgcc
gccatccgcacgttcaatccgaacgactactgggccgtcggccaggactag

DBGET integrated database retrieval system