KEGG   Sinorhizobium meliloti BL225C: SinmeB_4395Help
Entry
SinmeB_4395       CDS       T01884                                 

Definition
(GenBank) hypothetical protein
Organism
smq  Sinorhizobium meliloti BL225C
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Pox_A14
Motif
Other DBs
NCBI-ProteinID: AEG08677
JGI: SinmeB_4395
UniProt: A0A0E0UPT9
Position
pSINMEB02:1017872..1018057
Genome map
AA seq 61 aa AA seqDB search
MLTHDDRNMPERRATAAFPIGLILLAICAIFAYLAIGGAMLEGETETVVYTPPIADAPEP
R
NT seq 186 nt NT seq  +upstreamnt  +downstreamnt
atgttgacccatgatgatcgcaacatgcccgaaaggcgcgccacagccgcatttccgata
ggtctcatactgctcgcgatatgtgccatcttcgcctatctggcgatcggcggcgccatg
ctggaaggtgaaaccgaaacggtcgtctacacaccgccgatcgccgacgcgccggaacct
cggtaa

DBGET integrated database retrieval system