KEGG   Streptococcus pneumoniae 670-6B: SP670_1369Help
Entry
SP670_1369        gene      T01308                                 

Definition
(GenBank) pseudogene
Organism
snb  Streptococcus pneumoniae 670-6B
SSDB OrthologParalogGene clusterGFIT
Position
1285886..1286997
Genome map
NT seq 1112 nt NT seq  +upstreamnt  +downstreamnt
atgttaatcggaatcccaaaagaaattaaaaataacgaaaaccgtgtcgccctcacacct
gcaggtgttcatagcttagttagtcgtggtcatcgtgtccttatcgaaacaaatgctggt
ctcggttctggctttactgatgctgactatcaaaagcaaggagctgagattgtcgctact
gctggtgaagcttgggcagcagagttggttgtgaaagtaaaagaacctttaagttctgaa
tacggttactttcgcgacgatcttcttctcttcacctacttgcacatggccgctgctcca
gaattagcagatgctatgttagcagcaaaaacaacaggaattgcctatgaaactgttcgt
gacaatcaaggacaactaccgctcctcgttcctatgagtgaggttgcagatcgtatggct
gtttaaatcggagctcacttccttactaagcaagctggtggctctggtgttctacctggt
ggtgtaccaggtgttccaaaaggaaaagtaactatcatcggtgatggtgtcgtcggtaca
catgctgcccgcatcgcccttggtcttggtgctcaagtgactattttagatattagtgcc
aagcgtctctcagttctaaaagaagtctttggaagtcaaatttaaactcttatatctaat
tcattcaacattgaagcaagtgtgagagatgctgatgtggtgattggagccattctcatc
cctggtgcaaaagcaccggaattggtgacagatgagatggtcaaacaaatgcgtccaggc
tctgtatcgttgaccttgctgttgaccaaggtggccttatcgaaacagctgaccgtgtga
caacgcacgatgaacccgtctatgaaaaacacggtgttctccactataccgttgccaata
tccctggtgcggttgctcgcacttcaaccatcgccctaaccaatgtcactcttccttata
tcgaagctttggctggcaaaggattcgcacaagcaatctctgaagatgaaggcttgcgtc
aaggtgtgaccacttatcaaggttacttgactagcctaccagttgctcaaggacttaatc
gtgactacactgatatcaatgatttagtataa

DBGET integrated database retrieval system