KEGG   Streptococcus pyogenes NZ131 (serotype M49): Spy49_rRNA5s5Help
Entry
Spy49_rRNA5s5     rRNA      T00780                                 

Definition
(GenBank) 5S Ribosomal RNA
  KO
K01985  
5S ribosomal RNA
Organism
soz  Streptococcus pyogenes NZ131 (serotype M49)
Pathway
Ribosome
Brite
KEGG Orthology (KO) [BR:soz00001]
 Genetic Information Processing
  Translation
   03010 Ribosome
    Spy49_rRNA5s5
Ribosome [BR:soz03011]
 Ribosomal RNAs
  Prokaryotes
   Spy49_rRNA5s5
Non-coding RNAs [BR:soz03100]
 Ribosomal RNA
  Large subunit rRNA
   Spy49_rRNA5s5
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(1248018..1248134)
Genome map
NT seq 117 nt NT seq  +upstreamnt  +downstreamnt
gttaagtgacgatagcctaggagatacacctgtacccatgccgaacacagcagttaagcc
ctagaacgcctgatgtagttgggggttgccccctgtgagataaggtagtcgcttagc

DBGET integrated database retrieval system